Description :
From Genome Similarity Track
Location :
Scaffold_208:32989- 34110
Sequence
1121 bases(100 bases per row)
GGCCAAGGTGTTGACGCTATCGACACAGGACGTTCAGAACCTATTCCACTTCTTtGATGCCAATCACGACGGATCCATCGACTTTACcGAGTtCCTCTTG
GgTAtCCGCGAGCCCATGAGCGAACGCCGCATGCTGTTtGTGCGCATGGCATtCGATCtACTTGACAAAGACCACAACGGCGTACTGGAGGTGAGCGACA
TCGTCGATGTGTATGACGCCcGCAAGCATCCCGAGGTGCTCTCcGGTCGCAAGACGGAGCACGAAGTGTTCGCCGAATTTCtCGAGAGTTTCGACGTCGA
CCATCTACACGAAGGCAGGATCTCGTTTGATGAGTGGACTCGGTACTACCAGAACATCAGTGCGTGCATCGACGACGACGACTACTTCGAACTTATGATG
CGCAATGCATGGCACATCAGTGgTGGCCATGGCTGGTGTGCTagCACCAGCAACCGACGGCtACTTGTCACCCACGCGGACGGCTCGGCGACgTGGAAGA
AGTGCAGAaCGACcTTGGAGTCAAACGCGAGGATGCGGCTCGGGTGCTTGCGGGACAAATGGCagCGGCAGGTCGCGGGTCGTTCCAGAAGACGAGCTTC
TACGATGTCCTGGATCATACACCACGTCCAGTGACTGCGCCGTCCGGCGGGATTGGGATGGTGCGAACCAAGAACAACTCGAGTCAGGGTCTAGCTGCAT
GTCTTGGTGCTTCGGATAAGTCGAGCGAGCTTCCCAAGCCACTAGAGATCATCACACAGCCTCCATCACGCCGCCGTGGCTCGTTACCAGTTCcGGTAGG
CAGTAATGGGTTGTATTCACCAGCAGCATCAGCACCCGCGGGGgTTCAGGTCATCATTGCCAAGCTGAAGACGTaTCTCAAAGCTAAGGGCGCCCAtGGC
TTcTGTGGCCTAAGCCGTAAGTTCCGCATCATGGACGACGATGGCAACGGGTCGCTGAACCTGAGCGAGTTCCGCAAGGCCATGCGCGAGTGCGACCTGG
AGCTGAATGACGCTGATCTGCGCCTGCTCTTCCAGTTCTTCGACCGTGATCGCAGTGGCTCGATCTCCCTGAGTGAGTTTCTGTATGGCGTGCGcGACCC
GATGAGTGAGCGGCGGATGGG