Description :
From Genome Similarity Track
Location :
Scaffold_26:329846- 332292
Transcript NameFunction/comments
Phyra_77759Hypothetical protein
Phyra_94911Hypothetical protein

Sequence
2446 bases(100 bases per row)
TGTATTTGCATAAAAGTTTGTTGTGCGCAGACTTGCATTGGCAAGTACGTTAACGATCCGAAAGGGTCGCCCTCGCGGTACTTATAAACCTGACGAGCTG
TCTTCCGATCGAGAGAGCGAGTCACTGTTCTCGTCGTCTGCGGACGAGGAATGCCAGTCAGAAACCAAAGCACTATCTTCCATCGAGGAATCTTGAGATC
CTGAGACCGAATCGAAAATCCAAGTGTCCAAGGAAGTGTCCGTGGAAGCCGAGCCCGAAATCAGGAAGTCTTGCTCACTGCCCGACGATGCGCTCTGCGA
CTCGGACGCGTCAGACGCCGAGCCCTCGACAGATCCGAGCTGTGAGTCGTCAGTCCAGGTTTCAAGTGGGTTGATTATAACCTCTTCAAAGGACGAGGCA
CCTGTACTGTGGTTCGACCCACTCGCCGATTCTTCGTTCAAGCCCGATAGACCAGCAGTTGCCTCGCTTGGCGAGTCGTCTGAAGTGTCAACTGACGAAT
CCTCGGACTTGTCGGCAGTGGAAGAGCCGAGCGTAGATTCATCGGTCGACGTCGACCCAGTCGCACCATTGTCAGCTACAAGGCTGCTTGACCCACTCAC
AATCGTTACACCACCAACATTAGCGTTATTAGCTGGCCCCTCGGCGCTTACTGCCGCGCTTGTGGTCTCTGACCCGTTGTTCATGCTTGCGATCGCGATG
ACGCCGAACACCACTCCACACACCAGAAGCAACGTAATCGCCCCGCGGGTGGCCCATGGGCGTGTCATCGGTACCGGAACCGACCGCAAAACTGGGATTC
GCGCGAGTGTTCCGCCTTCCATCTCGTCAAGGCGGTCAAAACCACCATCGCCTGGGTGGTACAGCAAGTTGTTGTTCTCGGTCATCATGTTTGCGGACTT
GTTGGCTTCAACGGGGAACCTTCAAAAGGCTCTTTTGTCGTGTGTGATCTGTAGCCGTCTAATGGGGAAATGGCCACTTCCCTCATCACCAACGTAAGTC
CGTTTGAAACGAATGAGCTGCGATCGATCTGTCAATATTTCTCCACCACCACTTCCCACACAAAATCAAAAATAGTCCATGACCACATGGACCAGCATCA
CCCACACCGCACAACCGGGATCGGAGCACTCGTCCCATGCAGCAAAAAAGTCAAGAAACAAAACCAACATGAGACCCAGCAGTGCCTTCTGTAATAGGTG
TGTCGCACACCACACGATACACCTTTCACAACAAAATTGTACTCTTAGCCTCAATCGGTGACCTATTTCTATTATTCGTGACCACATACTTCGTGTATCA
CTTGACAATGCTGCGCGCGCTCCTCTCCGGACGCGGCGGCTTGCCACACCGGCTACAGGCCACGTCCGGCAGCAGCTCAAGTCTTGTGAAATTCTCCAGC
GTTTCCTCTACCTCCCCATCAATTAGACACGTGCGAATCGACCTGTGGAACGCGCGTGCGTGGGTGGAAAAAATCGCCCCAGCGCTGCAGACCTTCCTGG
CTGTGGAGAAGCACCTGATGGTCCCACTAAAGTTCGTTGTTCCTCATGGAGACGCTAAATGGCCCGTGGAGGCGTGGGGCTACCCGCTGGGACTTCATTG
CAGGAACCTGCGCGTGATCAAGCAACAGGGGAAGAAGCTGCCGTTCTTCGCTTTGGACGACCTGGAAATGTTTGACTTTCCGTGGGATATGCGGCAACGC
AAGTGGGAAGTGCTGGTGCTGCCTTCCCTCAAGAATTTCTACGAGATCAATGGCCACAGTGACATCCCCAACACTTTCGTGGTGCCCAAGGGCGACCCTC
AATGGCCCGAACTGCTTTGGGGGTTCCGACTCGGACAGACGGTCATGAGTATGACGTATGTGGGCACCTATAAGGCTCAGCAGGCAGCTTCCGAGGACGA
ACTGGTCGCTATCGGTTTTGCTGCTGTCTCGTGGAAGGAGCGCCAATGGGCGAAGAAGATCATGCCGGCGCTCGTGGCGTTCAGGCGCGAATTCGGACAT
TGCAATGTGAATTTCAACTTTGTGGTGCCGAGGGACCCCAAGTGGCCAAAAGCGTCGCGAGGGTTGAGACTCGGAGCCACAGTTGCCAACATGCGCTGCC
GAGGCAACTACGAGGATATGGCGCAGCGAGACAAGCACAAACTGGAGGAGATTGGATTCGTGTGGGACCCGGAAGACCAGCGGTGGACCGAGAGGATCAT
GCCAGCGTTTGAGGCGTACCGAGACATTTGTAAGGTCAGTTGGGTGCCTGTGGACTTTGCTGTGCCGGATGAAGAGCCTTGGCCGGAGATAACGCATGGA
TTGAGACTGGGAAACATCTTCATGAAGATTCGACACACAGGAGCGTACTCGTACTATATAGAAAGAGATGGGGACCGCTTGAAAGCGCTTGGATACGATT
TCAAGGTGCCGTACGAATCGCATGCGATGCTGAGGGATGCGTTGTG