Description :
From Genome Similarity Track
Location :
Scaffold_98:32979- 41615
Transcript NameFunction/comments
Albla_Nc14067330tRNA (guanineN(7))methyltransferase putative
Albla_Nc14067340Ptype ATPase (PATPase) Superfamily putative

Sequence
8636 bases(100 bases per row)
ATGCACACCTCGCAGGGTACCCGGCTGATTGCGGGACCAGCACGTACAAATACCTCTCGTACGCAAAAGTACTTCGTGATCGTGGCCTGACTCATCCGAT
GCGATATTCCTCGGTTCATTTGGATGCTGTGGGGAACCCAAGGCCAGAACTCCATCCGATAAGCACCGATTTCGGAGCACATGCGTTCCACAATCTCCCG
ACCGACTCGCTTGTACTGAGCCACTATGGAATCGGTCTGACGTTGTATTTCAAGTTTCTCAAGGTCATGTCTTGGCTTTTCTTCCTGCTTGTTATCATCA
CATTACCCATGCTCGCGATATATGTGTCCGGAAGCGAGTCTCCCTGGGAAGAATTCAAGGTTCTGTACAAGCAAAATGTTCCGTCTGTGATGAGAATGAC
CTCAATCGGGCATCTCAAAGAGTCCAGTAGCACGTGCGACCAAGGCGTACAAGGCGAAACAATTTCTTTGTCATGCGCAGCTGGAGAAATTGGCTTCATC
AAAGCCGTTTACTCGGAACTAGCGACCCAAGGCTCATGTACATGCCCAGAACGCAACAAAGTGATGACAAAAACCGGCGAATGTCGTGCTCAATACAAAG
AAGAATGCACATCTCACAGCCGGTGCACCAAAAGATGTTCCAGCAGCGACTACGGATGCTTTCTTGGAGTGCATCCCGTCTCCAAGGTCTCTTGTTGTGC
GGATGCTTGGGATTCTGCATCCAATGCTCCTAACTTTAGTGCTCTGACGATCAAAACGCTGGCTGGTTGTGTGAGTAAGAGCGCTCAGTCTATCGCGGAG
GGTCTGTGCTTTGGGAAAAGCACATGCTCCTTCGTCATCGATGAGGACGCAACGTACACGTGGACCAAGTTGGAGAGTCAAAAGTCTTGTCCGAGAAACA
AAACTTTGAAGGAACTTGGAACCATTTGCATGACCAATATCAATGATTCGAGCGATTATTCTGCGTGCCCGGATCCATCTACGCGCGGTCTGCTGGTATT
TGCGCAATGCTTCACCACATCAATCAATCTCTTCAATGAATGGAGCTTCAAGATTGTCGGCTGGAGCGCTATCAGCGTATGTATGCCAATAATTGCAAGC
GTGAGCTCATCATGCTGCTGTAGAGAAATCAATACCTGGGCTTTGCAGTTGGGTGTGACATTGTCTGTTCTTTTTTGTTTCTCGCAATTGTCTTGTGGAT
GAAGCGAAAGGAAGCTGCTGCGATCGATCGGATCTCGAGAAATCAGATCGTTGCTGCCGATTACACTGTTCAGCTGATGCATTTGCCCAAACACACCGAC
CTCGATCAGCTACGAGATGAGGTATTTTGTCCTCCACCTGCACTTCAATCTAAATCTCTTCCTCCAACAGCTTCGAGCTCATCTGGAGAGAATTCTCACA
GCCGCCGAGCCTTGCACGCGTAAATTTGATCACATACGCATTGCGGATATCCAATTCGGTAAATCGACTTCTGGACAGCTCAAACTTCTCCGTGATCGCG
GTGTGAGTGTGCGTAAGCTGGAAGTAGAGATCCAGCGGTTGGAAAAAATCAAGCAGCTCGAAGGCAAATTGGACCCCAAAAAGTATAACAGCAGCATACT
ATCGCATATCAAAAAATCGAGAAAGCTGGATACAACGCTGCAGAAGCACAATGTCAAGCTCGAAAAATGGCGTAAGCGACATGGAGAAGGTACTCGAGCT
CAAGCAGTGACAGCCTTCATAACTTTTGAAGAGGAAGAAGGCTTCTACCGATGCCTGCAAGTGTACCCGGACCTGGGAGCTTTGCATCGCTTTTTCCAGC
CGATGGAGAGACGACTGCATGGCAAACGATTACGATTCTGTCCAGCACCAGATCCAAGTGATATCAAGTGGGAGAACCTGCACTACTCGGGTCTCGAGCG
CTTTTTCCGGCGATGGATTGTAAATCTGTGTGCCTTGTCCTTCCTCCTCCTGAGCTTTGTCATTATATTCCTGGCCAAGTACGAAAAGGGTCAACTTGAC
CTGGAATTCGGACGCACGACTTCTTGTCCTGCAACCATCACCAAAGACGACGTCGTGTTGGACGAATTCAATAAACAGACGGCAGCTTCCGTGTACAAAG
CGCTTGTCGGGTGTTATTGTGAGTCTCTGTTGCATCAGATGTCTTTCCAGGAAATGATGAATGAGGAGTTTGACGTCAATGCGCTTACGGGAGGCACACA
GAGATATTGCAAAGTGTGGGCCAAGTCATTCGTCACAGCCCAATCGCTCTCGGTGGCTTCTATTATGATGGTCGTACTCGTGAACCTCTTACTGACGCGA
ATCTTGAAATTTTTGGTGAAAATGGAAAAGTATCACACCGAGTCGGGGCACATAATTTCTCAGGTGATCAAGATCTTCTTTGCACAACTCTGCAACACAG
CGTTGTTGGTGATCATCATCAATGCAAACGTGCAGTCGTTTTATCCGGCGAATAGCGTGACTTCCATTAACGTTTCTTCTTTCCAACTCCTCAGCGGTAA
ATATGGAGATTTTTCGACCGAGTGGTACCAGGACGTTGGTGTATCTCTCATGCTCACCATGATCATCAATATTCTATCTCCGCATTTGAATGTGTTTGTG
ACGTATCTGCGCCTCGAAATTGAACGCTTTTGGGATCGCGGGTGCACCTTTGACTACTCCAAGACCAAGCAAGACACACAGCGGGATTTAGAGGCTTTGT
ATCGTGGACCGAAATTCGACCTCGCGCAGCGCTACGCACAGATTTTGACCACGATTTTCATCACATATCTTTTGTCCGCTGGAATGCCGCTGCTTCACGT
AATTGGGTTTTGCGGTATATTCATCACATATTGGGCCGACAAATTTAGTACGTTTCAGGCTTTTTGTGTGTTTTCGCTGACTCGATACGGCAGCCTTCCT
GCGAATCACGCGATCTCCTCCACTTTACGATGAGAAAATCGCTAAAATGACCGGCTCGTTACTTCCGTACGCAGTCTTGTTGCATTGCTGCGTGGCTTTG
TGGATGTTTTCCAACAGCATGATATTCCAGAACGTAAGTAATCGCTTTGTGCCAATATTTCTCTGCTAAAGTCGAATGCTCGCAGCAAGAGGATATCCAG
GTCGAGCTCCATTCACCCAGCATCGAGTTTATCGGCGAAGGAATCCCGTCCTTCCAGCCGATAGAGCGACAAAATCTGTTTCGACGAGTCACTCGGAAGC
AGGTGGTGGTCCTCTTTGGCTTCTTTGCCAGCGCCTGTGCACTCATTGTCATGCGGATACTTCTCGAGTACATTCCAGCCTTGTTCCAGAATCTCTGCCC
GATGCTCAAAAAGAACCTCACAAAGACCAAAGCAGTCAAAGACCTGCCCAATTATTTTGACGGTAGATTTGTTCTCTACCTCTTCGCTTGTGACTGAGCA
TCATGTCGTAGCCATTCCAACGATCATCCTGCGGGAAAAGCTCCAATCAAAGCGATTACGACGAGAGCTACAGCAAAAATTCCAGCAAGCGCTAGACAAA
CGAATGGCTTCCAGACTTCACAGCAAAGTCGATCTACAAAAGCGACGGAAAACAATGTCAGGCGCAGAGCAATATCGTGAGGAGAATTGGATCGTCGGAT
GCCATTCATATTGTACGTTGTCTTCTATGCCAATATTCCAGGCTCTGAGCCTTTTTCTTTCGATCTCACGCAGCAATCATCGACAACAAGGAGTACATTC
ACGACCTCGCCATCGACTCGCCATTCTCGGACGACATCCAGCTAGACAGAATACTCTGAGCGCTAAGATAAAAAGATACATTGTACTTGTAATGGAGCCA
TTAGATCCTATAACATAGTGAGGCCTGAGCCTGAGGATATATTGCGGCGCTATTGTGCGCCCGATGTCGACGATAAAGTCTCCTTTGCGGGCAAGCTAAA
TCTGTCGGAGAATCCATTCCTCTGGCTGAATACCATCTCGCCTTCCTGTGGACAGTTGGAAAACGCAAAGCCTGTGGCATTCCGGACCAATCTTGGTGAC
TCTGTTTCTCGTGAAGGTTTCCAGTCCTGAGCATCCCGTTTTCGCTTCAATCGATTCCATTCGCGCATGAGATCTGCTGGCTCGGGATAGAATAAAACTC
GAGCCGTTTTCGCGATATAATTCGGAAGTACAGCGACGATCGTTACCAGAACGAGACCAAACCAGAACCAAGAGGTCGTCACCAGCTTATTCAACGTAGA
ATACGCGGTCCCAATCTCGTAAATCTCTCCTCCAGTCCATCCGTGAACGTTGCAGAAAAGCGCTGCAAATAGGTAGTAGAATACCAGCGTCCCCACCGTA
GCGATGACATTTGTCTTCGTCCAATTACTGGTCATAAGAGCGACCTGAGCCGTTGACGCGGTGATCAAATACGTGTACGCTGCTACTCCGCAAGCCCATA
AGCCCACATCTTCTTTCCCGAATTTCGTCGGTCCATGCTCATCATTTCCAAAGTAATACACCACAAAGCCATTCGTGAAGAATGTGATCGCATAGATCGC
ATATGCGTGCCACATGCCCAAGCCGCACCACCCGAAAAACGTGACCCAATTAAACGATCGATTCCGAAGGCCATTCACATACAAACTGGGATATTGCATG
AGCACGGCCGGAGATACATCCTGATTGTACATGGCGATTACCACGATGGGAATCGTCGTGAAGAGCGCGTTGTAAAGCGTGAAAAAGATGCCGAAATACA
TAAGTACGCCGCTGTACATGGAATATGTCGCGAGAAAAAAATTCGACAGCGATAACGCAACATTCTAAGTTCAAAACGAGTGAGACATCGCCTCGAGCTT
GGAAATCAGTCTGCGTACCTTCATGAACGAGAACAAAATGAGCTTGGAAATGCGTTTGTAGCTGTAGTTCCCATGAACCAATAGTAAGCGCTTGAGGAAT
CGGAATTGTGCAAAAGAGTAATCGCTCGATAACACAGCTTGACGTCCTTCTTTCCCGGAGATTCCCACCCCAACATTGGCTGCTTGAATCATTGGAACGT
CATTTGCGCCATCACCAATCGCGAGACTAATGTTCCCAGGAGAAAACATGAGCGTTGGCTCAGTCACAAGCTTCACAACCGCTGCCTTTTGTGACGGAGA
ACATCGACAGCAAATGACAGATTTGCATTGTGTGGCCACTGCTAAGAACAAATACTTGATGTCATTGTCCAGCACAAGCGAAAGCGTTCGTCCATCGATC
ACCATCGCGTACCCGACGTCTTCATCTTGATACTCTTCGCTTTTGCCAACTTGTGCTTGCGGCTCAAACACTTGGTCACCAAGACCGTGATCCATTCCCA
AAGAATACACTTCTTCAAACATCTCATTCCCAACGTCTGGTTTATCGCCCAACGTACTGTGATGATCGCTTCGACTGGCTTGGACATTGTATTCGCATTC
ATTCTGTTTGTCTTCGCGATTTCGGACTCGACGACGACGTCGACGCTGTTCTGTCTGCTGATCGCGACCGACAATCGCCTGATGCAGCAGCTCATACAAC
ATTTGCCCAGCCTTTTTAGCGGCTTCCACAAGCACCATGGTCACGGAAGCATTCTCATCCGATCCCCATTTCTCATCCACAAGGTCTACGTAGAGCTCTT
CTAATCGCGATCGCAGGGATACTTTATCGCGTTGACCAAGCACAATCACATCCATGTCGTCATCGATCACCTGTGAGGACATACCGATGCTGATAGCAGT
CTCCTTTTTATCGCCAGTGAGTACCCAGAATTTGATCCCGGCCTTCCTCAATGACGTGATACATTCCTCTGCGCCTTCCTGAAGACGATCTTCAATAGCT
GTCGCGCCTAAAAGCGTCAATTCGACTTCAATAATCGCCGATACTTTCGAGATTTTAGCTGCTCGACCGTGCATAGACATTTCCGCTTCGCGATATAACA
CTCTCCATCGATCATACTCCTCTTGCGGGAGAGTTCGCATGGCTGCTGTCAGCGTTCTCAGTCCTTCTGAAGCGTATTCCTGTAAATGTCCGCGAGTCAC
ATGAGCAACACCTTGAGGCTGCGACTTAGAAAGCAGGTCGAATATGACATCATCGGCACCTTTGCAGTACAATACGATACGCCCATCAGGATGTCGGGCG
ATCACAGACATTCGCTTACGATCACTGTTGAATTCCAGGACGTGGAGAATCTCAAATACCATCGATCGACCTTGAATGCTAGTGTGACACAGGCTTCCAT
CCCTTCCAGCTAAAACGTACTCGAGCTCTTTAGCTGCGAGCACGAGCGCTAATTCATCCGGAGATGCCGCGTTGTATCGTATCACATGCGATCCAAGTGG
CGATGTATTCACGTTATCGGTAACACGTGACGTTTGATCGATCGAGTCATTGCTTTCCGGGCAATTGGTTCCGCTCACTTCGGGAATCACAGTGTTACAA
ATCGTAAGAAGCAACAAGAACTCGTGAATATGTTCTTTGGTCGAGTGATTCGTATTCAGACGCGCCAGCAGTCTTTGATCTGTGAACTTTGTACCGGGTA
TGTCTCCCGTATCTGCTGGACCATGAACACTTGCATCCACGTCGTTGTATCGCAGACCCGCGATCGTACACTTTGCAAAAACCATCTCATTACGCGTTAA
TGTGCCTGTTTTGTCCGAAAAAATGTACTGAATCTGGCCCAAATCTTCGTTGATATTGCTGTTGCGTACTTGTGCGGGTGTGTCGGTAGTCGCGTCATAC
ATTTCCAGATCGTTCTCGATATACCGCGCATGCACGAACCGCACGCCTTCCATGGTCACATACATGGACAATGGGATCAAGTTGTTGAAGAGGATCACAT
AGCTGAGAAATATGTAACTGTTTGATTCGCCCAAGCCAAGGTACCAAAGCGAAGATGTGGTGCCCGGGTCAAGATCCCAGTCGTTATTGCCCAAAGTGCA
CGCAATCGAAATGCCAAATAACAACAGCAAAACGAGCACAAACATAGTGTCCAAGCTCTTTTCCACAGAGCTTCGTTTCAGCGGCACACCCGATGAATTC
AGCATGATCTTGGTATCTCTGCCCGTATAGATCACCAACCCCATCGTCCACGTAGCATTTCGACTCTCACTTCCTCGAAGAATCAGATTGTCGATATTCA
AACTCGCAATTTTCTCGTCGTTCGCGTTGAGATTGTCGGTGTTCCCTTGTCGTCCGATTTCAGAATTCCGAGAGCAAGAGTTTTCATGACGATTGTTGAG
CTTGAGGACACCATCAAAGCTGAAGAGATCTTTATTAGGCTCATCACACTCGACGTAGAGTTGATGCTGTTGGAGAATATCTTCAGCGGTGAGGAAATGT
TTCGTAAGAGGCACAACACTTCGAATTTTGAGATTGGTTTCTCCGTCTAAATTTGCAGTTTCCACATAACATCGCCCGTCTTGTCGACTTGTAGCGAGAA
GAATACAATCAGCCGGAACTTCCTCTCCATCTCGCAGTAGTACGATATCGCCCACTCGAATGTCTTTCCAAGTAGCTTCTATCTGCAAAAGAGCCGAATC
TTCGCGCATTTCAGCATCATATCGCACCAAATGAGCTGGTCTCGAGTTGACTTGTTCATCTGACTTTTTACGCCTCAAATCTTCCGTAAAATCTTTGATA
GCCGATGTCGCAAATACAATCAGCAGAGGCGTCAAACTTGAGATTGGACTGACTGGAGAGAAGCTGAAGAAGCATAGCATGACGACCATTGTTGTGTAAA
TGTTGGCCAAACGGCTGAATTGCATTTTCAAAAAGACAAACGGGAAGTTGAAAAGTGTGTACTTGCTGCTTTCCACCAAGTTGGATGGGAATACAGCGTG
TTTCTGCTGTTTAGTCGACTCAGAACTGTTATTCTCCTGTGGTTGTTGCCAAGTAGAGTCATCTTCTGTACTCTTGAGAGAGCGTGAGAGAGTAGATTTT
TCTTCTCGATCGATACTTTCCCGGCAACCTACGACGATCACTCGACGCGATGCTGTGTGATCTGCTTCGTCTTCCTCTTGATCGGCACTTTTCGTCAGTC
GACTGAACGCTCCATCAAAAGACGAATTCAATTGTGCATCTGCTGGAGGTACCATAGTGGCTAAGGCAGCACGATCAAACTCGCGCGAGGATTCTGCTAT
TTTGACAAGACGACGAAGTTTCCAGCCATAAAGTAGTCCGCCGATATTGAGAAAGGAGAGAATGACAGAGAATAGACTCTGCATAAGTAAAGCAGTACCC
TCACTGACACTGGTCAGCTTCCCATTATATCCTTTAAGATACCATATCGCATCGATCAGTAGGCTCACTTGCATACCGATTTTGTAAAGCAGTAAGAAGC
GAGGTACAAGGAACTTAGTTCCATGCCATCCAAAAATCAACGTAATGTACTGCACAAAATCAAAAAAATGAGCCAATTGCATCTAAACATTTACGAGTAA
AAGCTTACCAAGATGACCACGGGAACAGTCGATCGATACGAGACTCCGAGTAAAATCGGGATGATCCTAAAAGTACAAATGCCGGCTTGCCATACGATAA
TAAGCTTGAGCCTCCTTCTCGTCTGGTAAATGGTCAGTCCCTTCAGAAAACAGAATATTTGCTCAAAAAAGCCCCAAACTTTATCTTCGGTATTCTTCAC
TTCAGCTTCCGACAATGCGGAATCCGTCATACTATC