Description :
From Genome Similarity Track
Location :
Scaffold_129:32979- 34453
Transcript NameFunction/comments
g12493.t1RAW34173.1 hypothetical protein PC110_g9514 [Phytophthora cactorum

Sequence
1474 bases(100 bases per row)
TTGGATCCTCTTCGTCCTCTTCACCCAGTTCCTCCTCGTCAACTGGGAAAATCGTCTCCGGTTGATGGTCGAACAGACTGGCGGCGACTGAATTGTTGTC
TTCACTCTGGCCACCACCAAAAGGAGGAGCACGGCCAGCGATGATCGACATGCGCTTTTGCGTTGATGACCTCTGCTTGTAGCCTACGCGGTCACGGATC
TGCGCCAGTGCCAACTCTGGGAGATCCCCGCCACGCTTCCACATCTGCTTGTTCGCATCTGGGGCAGGAGTGTCGAGATGATCCCCTTCGTCATCGTCTG
GCAGGACGTCCAATCTTGCTGCCTCTCGGCGACGAGCTGCAGCACGCGATCGGCGCAGCAAAAGCGGGAGCTCATTGTTCTTTTCCACTCGTTTACGTGT
TATGCTCGTCGGAGGCTCGACTGCCATCGTTTGATCCATGATCTCCGTGCTGATGGTTTTACGCTGTGGGCCCTTTAGGCGTCTCTTGTGGCGTGGATGG
AAGCGGTCGGTGGGCGGATGTGGCGCTGCGAGTGCTTGCGGTATCGCCGCGATAGTCGATCGGTGCCAAGATTTCATCTCCTTGACTCCTAGCGCAGTCG
AGTTTGGTGGCTCTTCTTCAGGTGGCCCTGTTAGCGGTGAATAGACCATCGTTTCTTTGCGCTGGACTACCTCTCGTCGAATGTTCACATCTGATCAAGT
TCGCACATCGTCAAGCAACCGAAACTAGGCTGAGATACTCACTGAAGCGAGTCTTACCTTGGGCCCCATAGATAAAGTAACCGGTGCTCGTGTTGTTTCC
AGCCCTAGCGGACGTGTCCTGCTGATCTTTGCTGTCTCGATTTTCAGAATCGATCAACTCACGTATCCTCGTATATTGTTCGTGCTCGCCCGTGATGCTC
CGAAGTTTCGCTACAGTTGTGCGCCTCGAACTCGCGCGTGGAGTATCAACTGCCGATCCAGGAGCCACTGCAAAAATTTCACGTGTCTTCGGTCGTGGCA
ATTGTGCCTGCACCTGAGGCTCAGTTGCTCCTGTTAAAGCAGTAGCGATATGAACAATCGAGGCATCGTTCCTCTGGGCACTGGTGAAGTCCAACTCATA
CAGGTGCTTTCGCTGAGGAACGACTACCGGCTGGGTTTTCTTGGACCTGTCGGCGTCAATGAAAGGGGCCATCATACTCAACTGACCGGCTCCAGTGTAG
GGGCCTGTATGGTTCTGCAGTGTGGCATCAAACGGAAGTGAAGACGGTGGGCGTATTGCCGAGCTGCTCGAAGTTGTTGGTGCCCGCGTTTGATGGCGCC
TTGGCGTCGAAGGCTCTCTATGTGAAGCATGACGGGCAACAGGATCGGACAAATTGCTCTTGTTGGCAGATACCACAACCTTCATTTGAGGCGTTGGTGC
AGTAGACACCAACGGAGTCCCTGGTTTGGCAGCGGTAGGCGAATCACCAGCGTCGTTCTCCTGTTTTTCTTTGT