Description :
From Genome Similarity Track
Location :
Scaffold_181:32978- 34389
Transcript NameFunction/comments
Phypl_g4831hypothetical protein

Sequence
1411 bases(100 bases per row)
cgcgctggcggagatactcctcgctcttctttTTCGACATGGAGCTCCCAACCATCGCCTCGCTCTCTCTTTTGCAGTGTCTTGAGCGCTTCAAGCGTTG
TTGCTGAATGATGCGAGCACGTCGCTCGGCGCTACTGCGACGTCATAAGACCGAGCGAGAATATTCTGCGCTATTCCGAGCCGACAGACCGGCGGAAATA
ACCAATTGGTGCAACGATCACTTCACtgttggaggagctgcgacCGTCACCGCTATCCAATATGATGCATGTAGACGCTCCCATGGCCTCCAGCTATTGA
TCAGACGCTCGTTTGTAGATTGGCAGACCTCAAAACGGAAGCTGTAGTCGGCACTTTGCTGCTTGACTTTGCCCAGCATCTCTGTGACGCTTTGAACGAA
GGCGGCGTTGGTCACGGTAGCTCCATCCTCTTGTTGGCAAAGCTGACTTGGAGCACCGGCCTCTCGAAGCAAGCCCTGCATCGAGAGCATTACTTCCCGA
GTAAGATACACCGTCCGAAATGCCTTATCCTCTGACCCCATTTTCACACACGCGAACGCGACCACGTCGCGAGGAAACATGAATTTGTTAGCTCCAACCA
AAGGCAGGACCTTGACAACATTTGCATCCCAGCGCAAATGCCGGGTTTTGGCCGACTCGTCATCAGTTGTAGCGCtttcgcctccttcttcgtgagCCTG
CAGGTCTTGAGTGAGTCGCTcttgctccaccacctcAACATGAAGCATGTCATGATTCTCGTTGCATTCTTGCGATGGAACGAAATCCATCTGTAGGATA
TCTCGCTccacgtacttcttgagctggGCGAGTTCAAAATTGGTAGATGGGGGTGAGACTTGCGATGCAGAGCCGCGTGTCGTAGAGATGCCTGTTTcgc
gttgaagcagctgaaagTGGTCCCAGAAtggcgacttcttcgaggGAAAAGACACTATCTGCGTACTTTCGACCAAGACGCAGTCTAAAACGcgtagctg
ctcgtcgtAATGCGACACCTCCAATCCACTCAAGCACAGAATTGCGCCCTCTTTCCAGATACTCTTGCTACCCCGGCGAAAGAcgaacgaggaggacgaa
gacgaagcgcgCTTCAAAGGGCTGTTACTTTTCTTCTTTGGCATACTGACCTCCATTCCAGATACGCGAATACTCATCAGGTGATAGCTTTGGTcagtga
cgaagacgtgcTCGACATACCGGGATGCCTTTGGTTTAATCTCGGGGTCAAGCAGCGAAACTTCTGCCTGCCTCttcgccgaggagctcacCTCATCCTG
CGTGTCTCTAGCtgcgaccagcacgacgcaAACACAGACGTCGATTGTTGGTCTACGCTCATTTCTGCGGCCGTTTAATCCATCTTCAAAATTGGATCGG
TAGTCCATGGT