Description :
From Genome Similarity Track
Location :
Scaffold_205:32975- 37335
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_205-snap-gene-0.16Glutamate synthase
Pytir_DAOMBR486maker-pir_contig_205-snap-gene-0.19Expression site-associated gene

Sequence
4360 bases(100 bases per row)
GAACCTGCGGAAACCAAAGCCTTAGGAGCACTCATTTCCCATTTTGACCAGGCGGCGGCACAAGCGACCCACCAAGCAAGCAAGCAAGCACGCAACCGCG
CGCGCATTCGACTTGAAGCCACTTCTCGCAGCGTTAGTGACGTGCACCCACCCATCCATTCATCCATTTGTGTGTGTGCCTCTTTGATCTGCTCGTCGTC
GTCGCCATCATCTTCAACCTCCGCGTTCCGTTTTCTGTGACGTGTTGAAGAAGAAGACCGAAACGATCTTTGCGTTTACGTCTGCGAAAGCACTCCGTAC
GTTAACAGTCTAGTATTACCATGCAGTCGACGCTTCGTTCGAATGTGGCGCGTCTTGGACGCCGTCAAGCCTCCTCCTCCACCACCACCACCGCTACGTC
CGCACGTCGTGGATACGCTAGCGCGGTGAACACCAAGGAGCAGGAGGAAGTGTTTGAGAAGCGCGATGGATCCATGGGCAAGATCATCAGCGAGCGCGCG
TTCATTGAGTTCAAGCGCCAGCCAGACCCGTACCGTCCGACGCTGGAGCGACTACACGACTGGAACGAGATCAATACGGACACGCGCGAGCCGGTGGAGC
GCAAGATCCAGGCTGCGCGCTGCATGGACTGTGGCACGCCGTTCTGCCAGACCAACACGGGTTGCCCTGTGAATAACTTGATCCCCGAGTGGAACGAGCT
GGTGTTCCGCGACGAATGGAAGGAAGCCATCGATCGATTGCACAAGACCAACAACTTTCCCGAGTTCACGGGTCGCGTGTGCCCTGCGCCGTGCGAGAGC
GGCTGCGTCGCTGGACTCGTCGACGATCCGATCACCATCAAGAACAACGAGTACGCGATCGTCGACCGTGCGTTTGAGGAAGGCTGGATCGTGCCGCGCA
TCCCGCGTCGCAACGGTCTTCGTGTTGCCATTGTGGGCTCGGGTCCAGCTGGTCTCGCTGCTGCGGATCAGCTGAATCAGAAGGGTTACCACGTGACTGT
GTACGAGCGTGAAGACCGCGTCGGCGGTCTACTCATGTACGGTATTCCAAACATGAAGCTGGAAAAGAAGACTGTGAACCGACGAGTGGACTTGCTGCGC
GAGGAGGGTATCGAGTTCGTCACGAACGCTGAAATCGGTGTCACCATGCCGATCGAGCAGCTTCAGAGCGAGAATGACGCCGTGGTGCTGTGCCTCGGCT
CGACGGTGCCTCGTGACATGGACATCCCCGGCCGCGAGCTGAAGGGCATCCACTTTGCAATGGAGTTTTTGACGAAGAACCAGAAGCGACTGATGCTCAC
GATCGACGGGAAGCTGCAGAGCGGATGGGACCGCAACTTCATCACAGCGGAAGGCAAGGACGTCGTCGTGATCGGCGGTGGTGATACCGGCACGGATTGC
AGTAAGTACCTCTCATTGTGTGATGCTTATTATGACTGTATGTTTTGTAGCACATGGATTTTTCGTATGGGTATCTAACTTTCGTTTGACTCGCTTTTGC
AGTTGCTACGTCGATGCGCCACCGCTGCAAGTCAGTTACGAACCTCGAATTAAACCCACAGCCGCCACCGTCGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCGCATCTACGGCGTCGACTACGGCCACGCGGAAGTACGCTCGGTGTTTGGCGAGGACCCGCGCAAGTACAGCAAGTTCACGAA
GGAATTCAAGGGCAATGACAAGGGCGAGATCACGCACGTGGTCACGCAGCTGTCGGAGCGCAACCCAGAGACGGGCATGTTCAAGCCGGTGGAAGGCAGC
GAAGAGGAGTTGCCGTGCGACCTGGTGCTGCTGTCGATGGGGTTTCTCAACCCGGAGCAGAAGCTCGCGGAGCAGCTGAGCCTGGAGATCGACCAGCGCC
GTAACATTCGCGCCGCGTACGGAGACTTCCAGACGTCTCAGGAGGGCGTGTTCGCCGCGGGCGATTGCCGAAGAGGCCAGTCGCTCGTCGTCTGGGCGAT
CAATGAAGGTCGCGGCGTCGCGGACGCTGTCGAGAAGTACTTCTTGGCGGAGGGATTCCAGCCGGAGGTCTCGCAGAACCAGCGTTTCGGCTAAGCTACA
GTAGAGAAGGGAATGTGAGAGCGAGTGTCAAGGGTGTGTCAACGTGTCAAAGAGGACGAAGATGGTGTAGTGCTAGACAAGGAGAACGAAGAACGAACAA
GGTGGTGAACGAGAAAGGTATAATTTGAAACATGTTTTATTGGGGAAATCAATGTGGTATTTGGCGAGTGATTGGCAATATGTAGTGATGATGGTGATTA
GCAAAACTGACTGAGAAAGCAAAATTGTGTGGCTGGACTGCTGTAATCGAGTCGGGTGAGGATGAATGGCTGGCAGAGTTCCTACAGTTTGAGGATGGGC
ACGACCTGCAGCAACTCGTCGATGCCTTCGAGTCGCGATTTCTTCTCAGCATCTCGAGTCTTCTTAGAGCCGCTGTTGGTGCTGGTGCTGCTGTTGTAGC
GCAGGTCCAGAATGCGAACGCCTTTGAGCATCGAGACATCACAGAGACGCTTGCAGTCGCTGAGGTTGAGCACGTGGACTCGCGCAAGAGCGGAGACGTC
TTCGATCAACTCACAGCCCGACAGGTTGAGTGAGTGCACGCGTCCGAGCGCCGACACGTCCCGCACGAGCTTGCAGTGTTTGAGCGACAGTGTGTGGACG
TTCTCGAGCGCCGAGACGTCCTCCACTAGGTGGCAGTAGCTCAAGTCGAGCGTGTGGATACTCGTTAGCCCCGAGACGTCCTGCAAGTGCGGACAGCCGG
CGAGTTTCAGCACGCAGACATTCTTGAGCGCACGGACGTCCTCCAGTCCATCGCAGAAGCGGAGATCCACTTCCCGCGCGTTCGCGAGCGAGGACACGTC
GGTGATGAGCGCGCAGCCGGACAAGTTCGCTCTCCGAACCGACTGCAGCAGCGAGGACGAGATGTCGCGCAGACCGACGCAGCGGTAGGCGTTGAGCACG
ACGACGCCGCTCAGGTGGCCCAAGTCGGCGATGCTCTTGCAGAAGCTGATGTCCAGTTCGTAGACGTTCGCGATGCCTTGCAAGCTGGTGATCCCCTGGC
ACCGACTGAGGATCAGGCGCTTGAGGTTGCACAGACGGCTGACGTCCGTGACACCCTTGCAGTTGGAGAGGTCCAGCTCTCGTAACGAACTCCCGTTTCC
AGAAGCGAGCATCGAGATATCGATCACGCCGTCGCACTGGCGTAGTGAGAGCGAGGTCACGCCAGTGAGAGCCGACACGTCTGTGATCTCCTTGCACAGC
GACAAGTCCAGCGTGTGGACGTTGCCCAAAGCTGACACGTCGGCCACGTTGATGCAGCCCGTGAGGTCCAGTTCGTAAACACCACCGAGTGCGCTCACGT
CCGTGATGCCGAGACACTTGCGCAGTCTCAGCGTGTGCACTCCGCCCAGCGCGCTCACGTCCGTGACGTTGATACAGCCCGAGAGGTTGAGCGTGTGCAC
GTTCGCCAGACTGCTGACGTCGCGAAGATCGATGCAGCCGCCGAGGTTCAGATCGCGTACGTCTCTGAGTGCCGAGACGTCTCGCAGCAGCGGACAGTTG
CGCAAACTGACCTGCTTGACGTTCGCCAGAGGACGCACGTCGCTCAGCCCTCGACACACGTTGAGCTGCACAGACTCGCAGTGCGCAAGCGGCGTGACGT
CGGTGATCGTGTGGCAATACGAGAGGTCGACGCTCTTGGAGTGTGCGAGGAAGGACACGTCCGCCAGGTCGCTGCAGTAGCTCAGGTCCACGTGCGCGAT
GCCGTCGAGGAAGTGCAGTCCGTGGATGCGCGTGCAGCCATCGAGTCCGAGCGCCTCGAGCTTGCTGATGCCGTCGAAGAGCCGCACTCTGGGGAACATC
GAGAGGTTGAGTCGCTGGATGCGGTGGTTCTGGATCGCAGCCTCTAGTTCCGGCGGACAGACGTAGTCGAGAATAGTGGCGGAGGTCCCTTCTTGGAGAT
AGTGGTCTTCCTGTGCGAGAAGTAGCGCGGCTTCGTCTTCAATAGTCTCCACCGCCGGGTCATGGCGATGGAGGGTGTTATAGATACTCTCAGGAGCTAC
GACGGATGTCTTCGACATAATGGGCTGGAAGGACACGCTCTTTAGGTTGGGCCAAATGCGTTGCACACGCACGAGCTCGTCCACGGTCGTCATGAGCGTG
GCCTCCATGCGCAGGTCCACGTGCTTGTGCACAATCTCGTAGCAGAAGCGGTTCACCTCGGCGAGCGTCACAGCCTCGTTGAGCGTCAGGAAGTTGACGA
GGATGGCGTTCCAGAGCTCGAGCGGGAAGGCGGCTTCGAGGTAGTTGGTGGTGGTGGCGG