Description :
From Genome Similarity Track
Location :
Scaffold_177:32972- 36891
Sequence
3919 bases(100 bases per row)
TACCCTAATTTTGGCATAAGACGATCAAGGCTGACCGTGGAGACTCCGGGAGAGCGCCAAACAAGAACACGCAATTGGTTGAGGTATTTCCACCCGATCG
ACAACAATCTCTGCAACAGTCAAGTTCAGCATCGAGTCGAGTCCACCCAAAAGAGTGCAGCCCGCCCTACCGACGGGTAAACAAGGTGAGGAAGGAACAA
GTGCAAGCGAAATCGGAGTACCACCTCCGTTAGTCGGTCTTCTGGGCGCCAAGGGAGATTTGAGATCGCCTCATAAAATGAGCGAACCCCACTTCACCAC
ATTTGAGACGAATCAAAAACGGACAGAACGCAACTTGAACTCCTGATTCGGATGTAACAGCCTGTCGCAAGGTCAACTTTCGCGGCGCAAGCACCTCCTT
AACCCTGGACGGATCCCGATACGGCATAAGGAGTCCAACGTAAAACACGGAGGGTGTACGCAATTTTAGCGGTAAGTGAGCGTATACGCAATGCCCTTCT
TAGCCACAACCGTAAATGGTCCTATGAAGCGAGGACGCAGCTTCGTCTTAAACACAGCAGACACTACATTTGTAGGTAGATTCTTAGCGTTTAGTATGAC
TTGTTCAACGACCTCATAACTTTCAATACAGCTTCTGCTTGTAGCATCCGCTTGTTCCTTCTGTTTGTCTTGCCTATCAGCCATTGCGTCACGCATGTTT
CTGAAGACATTCAATCGCGTTGTGAGGAACGCGCTAACCTGTTTTTGAACAGTACCAGGGTTGACATCAGCAAGCCGATTGGCCACCTCTCCCCACCAAG
CCCTGAACCACGGATTGTTAGCGTTAACGGAACGCGGGTGTGTAGGCCGTTCATGTAGAACGGAGTATATCCTCTTGAGGCATGGACGGCATTGTTCATG
GCGAATATACTGATGGGGAGCATTAAGCTCCAACGCCGAGGCGTAACAGCTCACACGCTGCGTAGGACATTGTCGAGGACGCGATTAAAGTGCTCAGCCT
GACCATCGGTCTGCGGACGATCCGCTGCAGACGTGTTTAATCTGGTGCCTAGCACCGTGAAAATGGACCCTCAAAGTTTAACCATGAAACAAGGGCCTCT
GTCCGAGACAATTGACAATGACAGACCATGTTGCCAAACCATGCGATCAATGAACAGCAAAGCTGTCCCTTTACCACCAATGCAGTCCGGAACAACCGCT
GAGTGAGAAATCTTGATCAAACGGTCGACAAAGACCACAATACCAGTGTTGCCGTCCAAATCCTTCGGTAGGCAAAACGCGAAGTCTATGCTGATGGAAT
CCCAACAACCAGAGGGTACAGGCAAAAATCTAGCTAGAGGCACAGCCGCATGTGCGGAGGATTTGATCTGTTGGCACGCCCCTACATGTGCGCACATAAG
TGCTTACCCATTTTAATTCTTAGGGACACCAATAACTCTGGATAACTAAGCCGTATGTCTTCTCAAGACCGAGATGACCGCTACGCGCTGTGTCATAGAC
CTCATAGAGAAGTCGGTACGTCAGCTTTTCATCATGAGGAACAACGATACGCAGGTATCCGTAGCATGCGTGCGATAGCACAAAAAGCCATTATCGATAG
AATATCGATGTAGCCCGTAAGCGAACATACCGACAATTTAATGTCCGAGTCCTTAAGATAATCGCTTGCAAGCGCTCGTAGCAAAGATGCACATTGTTCA
TCATTGGCGTTCGACGAAAGGATTGAGTCAGTATGACGACGACAGAATCGTAACATGAGAAAGCTCATAGTCAGGTCGGCATGACAACGCATCAGCCAAA
GTATTTTGCCCCGGCTTATACTTCACCCCGAAGTTGTATTCTGCAAATAATGAAAGCCAACGGGCCATCCAATGCGGGAGGTGAGGTGATTGAATCGCCG
TGCGTAAAGACGAATGATTGGCATAAACCACGAAAGGCTTAAAGCCAAGCAGATGAACTCACAAGCGGTAACCACAAGCGGTAACACTCTCGCGTCGCTC
AATATCTGTTTGTAACAGAGCACAGACAAAGGCAAATCGGAAGCGTCACAGACAACACTGAAAGGTCGATCAGAATCTGGCAAAGCCAAAATCGAGGCAC
GTCGGAGACTCTCCTTTACGGGTTTAAACGCCTCATCTTCGGTGCTAGTCCAGCACCACTCCATATCCTTTTTAAAAATATTGGACAATGGACGTCTTAT
ATCAGCATAAATCTCGCTATACTCGTGTAAGTCAGTGGCAAGGCCAAGCCACTTGTGCATATCCTTTTGGTTATTAGAGACTGGTCAATCCACTATGGCC
TTCAACTTTGCGGGATCCGTCCTAAGACCTCGTTTCCCAACGAAGCATCCCACAAATGGGATTTCGTCCGGACCAAATATGCATGTTGACGCATTATCGT
ACAGCTTATTTGTCGCATGCACTCGAGCACAACTCTTAAGTGGTCGATGTGGTTACCCAGTCCGACCGACCCTGTACTACACGGCCATGTGAAAAAATGT
CATCGAATAACGTTCGTGCATAAACAAGGTGATGGCGGAACAGTTGCTTCACCAGACGATTAATGTAGTTGAGGCATTGGAAAGCCCATGGGGTATTACC
AGCTACTCCCAAAGCATACCGCTCGGAGTAATAACCGCTGTGAGCAGGATATCACTTGCTTGCATGAGCAATTGATATTACCCATCGACCAGTTCGAGTG
CATAGTACATTGTACATCCTGCCATGTTGTTCTAAAATAAATCCTTTCTAGGAATTGGTGTCTGGGCCGGTATAGCCGCATTAAGCTTATTATAAGCATG
CACAATGCGCCACTTACCATTAGGCTTTTTGACACAAAATATCGGTGTGGAATGAGGAGACTTGCTCTCATGTACCATTCCAGCCGCGTTCTTAGCACTG
AAAAAATTGTCAATGGCGTCACATTGTTCCTTTTGTAAGGACCACTGCCGTGTAACGCAGTATTTTGGTTCCAAAAACCAAGTCAATCTCACGATGTACA
CCTCAATAGAGAGTTAGAACAGGCGGTTGATTTATGAGATACCACGTCTTGAAACTCCTTAACCAAGGTTAGTAGGGATCCGAAGGATTCTTCAAAATGG
ATGATCCACTACGTGCACTAATTGCCGCCTTTGTACTTTTTAAAGACCGTCTCATCTAAGAGAGACGATGAGTTCAACTTGTTATCAGGTCTTAGGACCA
CCATATAGTATAATTCGTCTGCCTTCAAGGCCTGAATGAACTCATATGCAGACATTTCGTCTAGCTCTAACAGAGCACTTAACGATGGGAGACCGCAAGG
CCGACTTCACCATCCACTTAACCTGTCACGCCATCGACCAGTGTGTATAGCTGATCGCTAGTATCGCTCAGCTACAACGAGTGTGAGTTATTGCCACTTA
TGAGTCTTCAGTAGTCTCACTTTGTTCGATTCACCGACCCCAAAATCGTTCCTGTTAGTGATCGCGTGGTCTGCCGACTGATCCTTACACCGCAGTTACG
GCCAAGGTGAAGCACCGGTTGTTGTAATATGTTCCCAAGTTGAAGCTGTTTAAGCATTTTAAGTCAGTTTACCGATGGTTGAAACAATGGAGAAAGGAAA
CGGCGGATATCCGAAGGGAGACGAGTCGACAAACGAAGGTGGCGGTTTGCAGGTTAGCTGCAACCGCAAACATGAAAGCCAGTCGGAAAACTGCAAGGCA
ACTCGTCTGTACCTCGAAAGAGATAAGCTAAGTGTTGTACATATCTTCGTGCGTCAAGATATAGGGACTGACTAGGTAGACACCCCCTACTTACTACGCG
ACACCCCTTGGTAGAATATATTATCCTTATCTTATTTTTTATTAATGGTGCCCTCCCCGAAGTTTAATACTCGTCAATCCTGATGAGCATTGCGGTATCT
CGTGTAAGTCGCATATCCA