Description :
From Genome Similarity Track
Location :
Scaffold_13:329582- 334789
Sequence
5207 bases(100 bases per row)
CTTCCTCTGACGCTAAAGCTACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGG
AACACCCCGTGTTCGCGAATTTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTCATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCA
AGGTCCAGAGGCGGTTACTGCCAGGCTGGAATCGTTCTCCCGCTATGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCG
GCGTCGATGACGCGTGAAGAGTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCC
GTGAGGTCGAGATGGCCATGGGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGC
ACTAACGTGCGGCACGTCTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCACGCCGCCTAATCAGGCGTACCGT
ATCCGGTCAAAGTTCCTTGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTC
TTCCGGAACTGGTCAGCGTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAACTCTTTGAAGAGGCG
GTGGATGTGCCATTGAATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACC
TCAGCTATGCTGAAGATGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGTCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGC
CTATTGCCCTCTGCGCAAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACTG
GGGAAGAACTGAGTTCTGTTGTGCCTCGAAGAGGCAGAGGGCAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCC
GGGCTTGCTGGTCGTTCAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACC
CTGGAAGGGAGTCAGCTGTATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGG
TCTCTGTCGACCTTGGAGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGC
ATGGCTGGAACGCCATGAGCCATGGATCGACTGGAAGTCGAAAACGCTAGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACC
TCTGCTAGGAAGCAGAAGCGCTTTTGCCGCGAGCACGAGGCCGGGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGTTAGCAACGAGGTTGCTG
TTTGCCCTGAGGGCGTACGTGGTGCGGCACGTTATCCGCTGAGCAGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGT
GGCACGTAGTCCACTGAGTGGTACGAATCTGGTCGATGACCTACCACTGCGTGGCCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGC
TCAGGAGATGCAGGTGAAGTGACACCTAGTTCACTGTGTGAAGGTCAAGGACCGCCTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTTGA
GGAGTGATGGTGCTGCTGCACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGCGGAGGGAGAGGAGAAGAAGACGCAGG
GCGTCGTGACGTCTTCGACGTCGGACGATGCGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGTTGTGAACAGCTGTATACACTTGTGAACGGAGT
GACGGGGGAGGTAGAAGGTGACATCAACCTTGACACTCTGCCCGCTGCGGATGCTCTGCTAGAGCTGGACGAGATGTCCATTGCCGAGTTTGGCGAAGCC
TTAAAGGCAGGCGAGCTAGCCGAGGTGGTCCTGCTGGGACCTGAGGAGAAGTTGAACTCCTCATCCGTCGTAGACGACGCGGTCCTAGAGGACACCAAGA
AGGCGCTGAGCGCAAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCGAAAGACCC
ACCAACGGGCCTGCCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAG
CAGTGTGACGTCATTGACGCATTCTTCCATGCGAAGCACGAGGCAGGGATGGTGCGCGAGAGTAAATCTCCGCACTCGACACCCACGTTCTGTGTCAGAA
AGCCGAACGGCAAGTGGCGCATTGTTTATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAA
CAACATGGTAGGCTGTACGTTGTACAGTGCGCTCGACTTGGTCGATGGTTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGT
ACTCCGAGTGGTATGCTCTGGGAGTGGCTGGTCATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGTTGTTTAGGCCCC
ACCGGGCGTACGCTCAGACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGC
GGTGCTCGAGTGCATGCGCACTAATAAGTTGTATGCGAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAG
CGTGGCTTACGGGCAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGCCAATT
ACTTGCACAAGTACAGCGCGAACTACGCGGAGATGGCTCGGCCATTATCAGATCTCCTAAAGAAGGACACACCATGGTGCTGGAACGTCGAGCACGACGG
AGCCTTTGAGGCTGTGAAGGAGAGCCTCCTCCAGGCTCCGATCCTTGCGCTACCGGACCCGGATAGTCCGTTTAGCGTCGTCTGTGACGCCTCCGATTTT
GCAATCGGTTGTGCTTTACTACAAGCAGACGCCGAAGGGCGTGAGCGCGTGATCGCGTTTGAGTCTCGCCAGCGCAAAGCTGCAGAGAAGAACTATCCAG
TTCATGACAAAGAGCTACTTGCAATGAAGTATGCTCTAGTCAAATTCAGGGTACACCTGCTAGGCTCTAAGCCTTTTGTGATATTTACAGATCATGCGTC
GTTACGCACTGCGACCAAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCTGAGTATAACTTCGAGGTGAAGTACAAGCCGGGG
CGACTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGTCTGACTTGATACGCGGAG
CGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACGCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAG
GCTGTATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACTCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAAAGTAT
CGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAAGATGT
ATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAA
GGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCGGGAAACACAGGTATAGTGGTCTTTGTAGACCGATTGAGCAAG
ATGGCTCATTTAGCGGCGGTGCCGGACACCATAGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTCGCCAACATGGCTTGCCTGAGGCAA
TTGTCTCGGATCGAGACCCGCGCTTCACCGCGAAGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCCCTCGTTTGGACATGTCCACAGCGGACCATCCGCA
GACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTCGCGGCAGATGCTCCCACTC
GTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAGCCCTCGCGTCCCACTGACGCCGCCAC
GCAGTGGCTCAGGGCTTGATGAGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGTTCGCAAGCAAGTCGATGACTTTGTCTCTTTGAG
ACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGAGGGGTTT
GAGGTCGGAGACCAAGTTTTATTAAACGCTAAAAACCTACCTACTCATGCAGTGTCTGCAGTCTTCAAAACGAAGTTAAGACCTCGGTTCATAGGACCGT
TTAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTTGGCTTGCTTAAGCCATATCA
AGACCCT