Description :
From Genome Similarity Track
Location :
Scaffold_68:329536- 332818
Sequence
3282 bases(100 bases per row)
ACGGCAGCCCCGCTGCACTTGGTAGCACTTGTAGTCAATCCCGCTCCTGAGTCGGTTGACTATATCCTCTGCGAGGATGGAACACCCCGTGTTCGCGAAT
TTGCCCCCGGCGCAGCAGGACGCGCTTACTAAGCTTATGTCCTTGCTTGGCCCGGAGGGCGTGGCTCATCTTGCATCGCAAGGTCCAGAGGCGGTCACTG
CCAGGCTGGAATCGTTCTCCCGCTACGAGAACGCGCTCTTGGAGCATGTCCAAGAGAAGATGAGCGCCGCAACGGCGGCGGCGTCGATGACGCGTGAAGA
GTCTATGAGACTGAAACCGCTCATGGTGAGCGTAAAAACCTTCGAGGGGAAGGATGGAGAGAATCTCCTTCTCTGGACCCGTGAGGTCGAGATGGCCATG
GGATCGGCCCTGCTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTGGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGTCTG
TTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCACCTAATCAGGCGTACCGTATCCGGTCGAAGTTCCTTGC
TACCCGCCAGGGTAAGAAGGAGTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTCTTCCAGAACTGGTCAGCGTG
ACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGAACGGAAGTGTTCCGTGTACACCCTAGCTCTTTCGAAGAGGCGGTGAATGTGAGATTAAATG
CCGAGCACAACTTCAGGTCGGCTCGACCTGGTTGGAGCGCTAGTAGCGCAAGCTCTTCGAGCGGTCCAGAGCCGATGGACCTCAGCTATGCTGAAGATGA
AGAAGCGGAGCTTCTTGCTGCGGAGCAGCGTGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCTCTCTGCGCAAG
AAGCGCGAGGCTCTGGCGAGCTAACTCTCCGGGTCATCGCTGGGAAACGGCAACTCCTCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGTTCTG
TTGTGTCTCGAAGAGGTAGAGGGCAACGGGGCTCAGCCTCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCTCGGCTTGCTGGTCGTTCA
AGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGCTG
TATGCTGAGGCACTGGAAGTGCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGGAG
TGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGTCATGA
GCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCTGCTAGGAAGCAGAAG
CGCTTTTGGCGCGAGCACGAGGCCGAGGCGGCCGTAGTGCTGGACATTGGTATGTCCGAAATTGCTAGCAGCGAGGTTGCTGTTTGCCCTGAGGGCGTAC
GTGGTGCGGCACGTTATCCGCGGAGCGGTGCAGGTCAGGTCAATGACCAACTGCTGGGTCCTGGTGAGGACGAGCGCGGAGTGGCGCGTAATCCACTGAG
TGGTATGAATCTGGTCGATGACCTACCGCTGCGTGACCCGAGGGTCGCGGTCGACTGCGAGTCGAGGCATCATGGGCGTGGCCCAGGAGATGCAGGTGAA
GTGACACCTAGTTCACTGTGTGAAGGTCAAGAACCTCTTGGCTTTCAGCCGAGTGTCTTGCGAGACACTGTATCCTCTTCGAGGAGTGATGGTGCTGCTG
CACCCGGTGGTGGTGACGGAGATGTCGCCACACCGCCCTCATCCGGCCGGGCTCGGTCGCGGAGGGAGAGGAGAAGAAGACGCAGAGCGTCTGTGACGTC
TTCGACGTCGGACGATGTGTCCAACGTGACGAGCGGTGATGCTCCACGTGATTGCTGTGAACAGCTGTATACACTCGTGAACGGAGTGACGGGGGAGGTA
GAAGGCGATATCAGCCTTGATACTCTGCCCGCTGCAGATGCTCTGCTAGAGCTGGTCGAGATGTCCATTGCCGAGTTCGGCGAAGCCTTAAAGGCAGGCG
AGCTAGCCGAGGTGGTCTTGCTGGGACCTGAGGAGGAGTTGAACTCCTCATCCGTCGTGGACGACGCGGTCCTAGAGGACACCAAGAAGGCGCTGAGCGC
AAGAAGTGGATCGGCGATCCTCAAAGATCCTTCGGATCCCTTCTACCCGGTGGTGAAGGAGTATGGAGACGTTGTCTCAAAAGACCCACCGACGGGCCTG
CCTCCGGATCGAGGCGTGTGTCATGAGATTGACCTGGTTCCTGGAACCAAATACTGCGTAACAAGGCAATGGCCTTTGCCGAGAGAGCAGTGTGACGTCA
TTGACGCATTCTTCCGTGCGAAGCACGAGGCAGGGATGGTGCGTGAGAGTAAGTCTCCGCACTCGACACCCACGTTCTGTGTCAGAAAGCTGAACGGCAA
GTGGCGCATTGTTCATGCTTTTAACAAGCTAAATGCGGCCACTATCCCGGCGCAAACGCCGATTCCTCGCAAGGATGTTCTGCAGAACAACATGGTAGGC
TGTACGCTGTACAGCGCGCTCGACTTGGTCGATGGCTACTACCAATTGCTCATGAGAGCGAGCGACATTCCGCTGACAGCGGTGAGTACTCCGAGCGGTA
TGCTCTGGGAGTGGCTGGTGATGCCCCAGGGGCTGTCGAACGCACCAGCAACGTTCAATCGTCTTGTGACGCAGCTGTTTAGGCCCCACCGGGCGTACGC
TCAAACGTACTTTGACGATATATTCGTCCATAGTCGTGCCGAGCACGGAAAGTCAGACGTGGATAACCACATTGACCACTTGCGAGCGGTGCTCGAGTGC
ATGCGCACTAATAAGTTGTATGCCAACTTGGACAAGTGCGTCTTTGGCGCGGAGGAGATACCTTTCCTCGGGTGCTTCATTGGGAAGCGTGGCTCACGGG
CAGATCCTGCCAAAGTCAAGGCCATCGTGGACTGGCCGGTTCCCAAGAACCAAAAAGACTTACGCAAGTGGCTAGGCTTAGC