Description :
From Genome Similarity Track
Location :
Scaffold_185:32949- 35210
Transcript NameFunction/comments
Hyaar_Emoy2812127hypothetical protein

Sequence
2261 bases(100 bases per row)
CACGCGCAATCCGATGCCGACGGTGAAGCCGCGGCGTCGGTCTAGTGACGTCTGGGAGCTCGTGGACGAGAACGACCGGCCGATCAAGATGGACAAGCGC
GATGATAAGAGCAAAAGGGAGTGAGTGATAGGAGGGAGGGAGAAAGGGAGTGCGGGGAAGCTGATAGGCGGGAGTGTCTGCTCATGCATCTGCTGTCTGC
AGCTTTTGCAGCTTGTCTAGCAGTCACTGACCCAGCATTGTAGTGGTCGGTCGGTAGGACCTTGTCAAACGCAACGTGGTCGGTCGTCAATTGATCGGTC
GGTCGGTCGGTCACATGGCTACATTTTTCGTGTGGACTATACAGTACCGTATACGACGTCGCAATTGAAGCGCTGTCACATCTGTTGGGTACAGGCGTGA
CGCCCCTGCATCATACTGGTCGGAAAAGCGCTCATGTCGCATAGGTAAAGTCGTACGCGCCCGCATCTCTCTCTGGCTCGCGCGCTGATTGGTTGCTTGG
TTGTGTCCTGTTTCTGCCAATCGCGATGGCTTCTCCGCGGTATACTCGAGCCAAGTGACGCGTTTCTCCGCCTAATCAGACGAGCGGCAGCCAGTCACCA
CTTCTCATTTGACAATGGCGACGCTGAGCGTCGTGGTCACGGGCTTTGGCCTCGTGCGCAACGGCGGACAGCAGCCCGACTGCGTGGTACGCTCTTCTAT
TTATCTGTAGCTATACATCCCATACCAACGCTACTAACCGCAGACCTCTCACGTGTCATATTCGATGTTATTTTACAGGTTTTCCTCGGAACGGTCCACC
AAAGCAGCAGCCACAGTAGCTCCTGGACCATTTACCGGCCGTTCGAAGCGTTCCAGCGCCTGGGCCAACAGCTGAGCATGATCTTTGGCCAGATGGTGCC
AGTGTGTCCGCCCCATCTGTTCGACGTGCGCTTCCCCGACTCGCTCGAGAAGGCGCGACTGGACTTGAGCATGTGGATGCTGCAGCTCCTGCAGCACGTG
CCCATTTACCAGTCGCACGTCTTTGTGGACTTTGTCAGTGCCGATGCCAATGTGCCGCCGCCCGGACTGCAGCAGGCGGCGGCCTTGGGTCCTACTGCAA
CTGCTGCAGCGCGCGGCGGTGGGAACATTGGCGATCTTGATATGGACGAGATGTTTCACTCGACGACGGACGAGAATCCACCACANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCACGACGAGCTGCACGA
TGATGATGTACGTGCCGTTATTGTTATTGTTGTTGGGGTTATGGGTTTTCATAGGGTATTA