Description :
From Genome Similarity Track
Location :
Scaffold_3:32936- 34147
Transcript NameFunction/comments
Pytve_DAOMBR484fgenesh_masked-pve_contig_3-abinit-gene-0.158Tyrosine-protein phosphatase OCA1

Sequence
1211 bases(100 bases per row)
TGGCATGACAATGTGGCCCATCGCGCGATCCGCAAGATCATGATCCTCAGGCTGCGTCGGCTGTATCCAGGTTTGACGACTGCGACTTCATCCAGTGCTA
GCGCGACTCCGTCGCTTGTCCAGCGGCTCGAATGGATGCTCTACAACGCAGCGTTCTCGCTCGAGGAGTACCGGAACGAACGGTCGCTCGAGCGGCGGAT
TCAGGCGCTTGTCACGCAGTTTGAGGTGACCACAGGCAGTGACAAGCAAACAGAGGAAGCGCGAGGATGCAAGCGAAGCAGCAGGTGCATTGAGCCAACT
ACTGCTGAAGATGGGTCTGATTTGACGCAGCCGATAGCAACCAAGCGGCAGCGACGAAATGATGTGACGACGGATGAAGAATGCGCTGTGATCCATGCAA
AACCCAGCTTGTTCATGCTGAACAACGACGAGAGTCTGGTGGCGAATGTGATGAGCTTCCTGGCGGGCGAAGACGTCTTGCGGTGCCGCGCGGTCAATCG
GTTTATGAGCGACGCAGCGCCAAAGATGGTGTGCTCGCTCCGCCTTGTGACGCGCTCGCCGTCGCTTGGCTTCGCTCCGTCCGGCTACCTGACGACACTG
CTGATGCAATGCACGCGGCTTTCGACGCTCACTGTGACGAATGGCGCGATCGAAGCTGCGATCCCGTCTGCGTTCTCGGCAATGCTGGAACCGGGTACTC
GGCGCCCGCTCCTCCGATCAAACGAACGAAACCTCTCGTCACCTGCTCGCCGCGTGCTGCGAGAAGTGGCGCAAGCGTTCCAAATCGGCGCGTGCCCCAA
CCTAGAAGCTCTCAAACTGCTTGCGCCAGTGGACCGCTTCGTCGACAGCAGTGACGTCGTCCGGCTCTTGGAGGCATTCGCTGCTGGTCGAGAACGTTTG
TTCGCTCGCGGTGATTGTGCGAGACCGCTGCTGCAGCTGAGCTTGAACTCGACGTTCCTCGGCGACAAGAGAATGCACCATCTCGCGCAGCTCTTCCAGT
CGCGAGAGTCCGATGCAAATCTCTCAAGTGGAAGCTCAAGCTCCACATCATCATGCTTTGCACAATTGCATTCCCTTCAATTGAGCAACAATTTTATCGG
GGAAGGCGGCTTTCGAGCGGTGCTCGACTTGCTTGGGGACCTCCCGAACCTCCGCACGCTTGACCTGCGGCGCAACATCCTCACGGACATTGACGGACAC
ACGCTCGCTGA