Description :
From Genome Similarity Track
Location :
scaffold_12:329203- 330282
Sequence
1079 bases(100 bases per row)
CTCGTCTacatgctcaacgaggtggctctcgtgtacccgcaatgcggatgaTATTCGATAGCGATAACCCAATCTCGCCccttggcgtctgcttgcagca
gtgcacagccgataacaaagtccgaagcgtcacagacgacgctgaaaggacgatcagggtctggcagcgccaNNNNNNNNNNcgacgatccacttcgtgc
gctcagcactctcttggtgtcctccaagacagcttgatccagaagcgatgacgagtttatctccttgtccggtcgtacaatgaccacttcggccaaatcg
cctgccttcaagacactgccgaactcttcaaaagaCATCTTgtttagctcaagaagagcttctactgcaggcatagcctcgaggcagacgtcgccatctt
tcttcttcgtcataccgttgacgagggtggataactgtgcaccgtcagctacggtagacacacccatGATAAGGATCGACGTCCGGCGTCtcgcagccag
catacggcgtcgccatcGCCTCTGCGCAGACAttttatgtctcggtgagaccagaatgaacacgcactccgcgtcgtccggtgtcaccctcacttttcgC
TCTtatggagctccgatgttatttacaacatccgacgaagaagggctgaCCCCACAGTCTTtgcccagtggataacgtgccactccacgcgcatctgaag
ggccgcgccCACGATGCCTCAGACTCTGTCctaccatgtcacgcatgacatgcagagactgcttcgatactcgagcagcgctcagtggtttacgtgccac
ttcacgtgcatcacacgggcctcgccctcgatgtctcGACCATGTCAAGCATGACATTCAGTGACTGCTTTgttacttgagcagcactcagtggcTTTCG
Tgtacttcacgtgcatcacggaagcctcgccctcgaccatgtcacgcatgacatgcagcaactgctccgaaacttgatcagtgctcagtgggttacgtgc
aactccacgatcagcccgcgagccacgctcgggactcctgtccaatacaccattggtgtctaccaaccagaacattcca