Description :
From Genome Similarity Track
Location :
Scaffold_1055:3292- 5879
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1055-fgenesh-gene-0.3Calcium-dependent protein 5
Pytar_ATCC12531maker-par_contig_1055-snap-gene-0.63-beta hydroxysteroid dehydrogenase/isomerase family protein
Pytar_ATCC12531maker-par_contig_1055-snap-gene-0.10Conserved gene of unknown function

Sequence
2587 bases(100 bases per row)
TCAATCGTCATCGCTATCCAAATCGTCCAGTGGGTTGCCCGAGCGCTTCTTCATGACCCGAAAGAACTCGTCTTCGTTGATGAACCCGTCGCCGTCGCGG
TCGGCCTCGTCGATCATCTCTTGGATCTCTTCGTCCGTCAGCGTCTCGCCCAACTCGTTGCACACACGCTTGAGGTTGCGGTACGAGATCTTACCCGTAT
TGTCGTCATCAAAGAGGCGGAAAATCTTGAGAATCTCTTCACGTGAGTCGCGCGAGTTCATCTTGCCCGTCATCATCTCGATGAACTCGTCCTGGTCGAT
CGTGCCCGACTCGTCCTTGTCAATGTCGGCGATCATAGTGCGGATCTCGGCCTTCTTGACCTGGAAGCCGAGCGCGCGCATCGCTGCCTTGAGCTCACGC
ACGTCGATCGTGCCGCTGCCGTCCGTGTCGAAGAGCCGAAAGGCCTCCTTGATCTCCTCGAGATCTTCCTCGTCCAGCGCTTTCTTCACGGGCTTGGGCT
TGCGCCGCAGCGCCGCGCGCGACCGAGCAAACGCCGCCGCCGAACTGCCAGACTGGACAACCATCACGTGAGACCTTTCTACTAGGGCGATGGGGGAGGG
AAGAGGCAGTAAGTACCATATTCGCGAGGGGATCACCAGAGGAGGAAAGTGAAAGAATGATCATGTGTCTGTGACCTTTGAAGATCCATCGGTATGGATG
AATAAATCACACCAGCAGTGTTTAAAACACTGGAAACGTATCCCTTGCTTGAGTGACAGTGTCCGTCAGTGGGTGAATTGTGACGGTGATATGTGACACG
CCGCGAAACGGAATTCGCCCGAATGGATATGAAACCGACTCAGTATTCCTCGAGCTCACTTGCCGATCCGAGAGCATCCGAGAGCTCCATGCGAAGCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCGGCGTACGACGCGCAAAAGCACCTCCTGCTCGTGGTCGGCGGCAACGGCTTCGTGGGCAG
CAACATCCTCCAGCGCGCCGTGCAAAAGGGCATCGAGGTGCGCTCGCTCAACAAGTCGGGCAAGCCGCAGTGGCAAGATGTGCCGTGGATCGACCAGGTG
GACTGGCACCAGGGCAGTGTGTTCAACGCCGAGGACCTCGCCAAAGCCGTCGATGGCGCCACGGGCGTTAGTACGTCCCTTGTGTGGCCGAGACGGTGGA
TCGCACGTGATGAACTGACAGTATGGCAAAATATTTGGTTTCTAACTAGTCTCAACTGTTGGCGCCTTTGGCGACAATGAGCTGATGGAAAAGATGTGCG
GCGATGCCAACATTCTCGCCGCTCAAGCGGCAAAGAAAGCTGGTGCGCTACCGCAACTTCGTTCGGTTCAGATTCACGTCCCAACATTAATGAATGTTTC
TGACTGGTAGGTACGGAGCGATTCGTCTTCATTTCCAACTCACGCGTGGGCTCGTACGTGCCGACGTGGGCACCTCTCTATGGCTACTACCATGGCAAGG
AGCGTGCTGAAGCCGCTGTGCGCGAATGGTACGTTTGCGTGGCCTACTCATCGCTTGCATGATATCCCCCTGAATTGATCGCGTTCGTATAGCTTTCCAA
CGACGGGAGTCTCTCTCCGCCCCGGCTTCATCTACGGCATGCGCCGCGCCAACTCGTACAGCATCCCGCTCCAGCTCTTTGGAGCACCAATGGCGCTGGT
GTCACGCAGCCTTGGGCCCGTCTCTAGTGTGGTGGCGAAGATCCCGTTCGTTGGTCACGAGATGCATTCCGCTGTGCCCGTGGAGACGGTCGCGAAGGCG
GCGGTGTTGAGTGCAATGGGCCCCGTTGAAGGCAACGCGCTTAACGCCACGAGCATGTTGGCGCTCGCAGAATCGTTCCACGACACAGTCCACGACACGT
GAAACCAGCTCAGTAGAAAGTCAACGCACTCAAACGAGTTCCCAATCAAGTATCATGTTGGAAATTGACTACCGGCTCGCCAAGGCCTGGGCTGTGTATC
TCATACCGACCACTCCAAACTTCTTTTTCCTCTCCTCAGCGTCGAGGCGCCGCTGCTCCATATCATTTGTGCGATCTTTCCAGTACCGGTCCTTGTGCTT
CTCGGTCTGCTTGGCGAGCTCTTGCTGGAGCGCCTTGGCCTCTTCATCGTTCGCGGCCGCCGTTTGCTGGGCCGCGAGCTCGTCTAGCGTTTGCACCCAT
AAATCGCGAATCGCAGTGGTTGCTGCGGTCAGCTCCAACAGCTTCTGGCCTCCCGCGCCAAGAATGATCAAATCGGTGTTGCCTGCAAATCCATCCGTTC
GTCAAGGCCGCGCCAGTGCTCAGCAGGACCATCGCATAGCACGCACCGCTCGGACACACTTTGCCCATGCGGCCAATCGCCAGTTCCTCCAACTTGTTTG
AGCCGACGGGCGTGACGCGCCACTGGAGCCGAGACGCTGTCGCGTTGAGCTGCAGGTAGATGGGCTCGGTCTTGCTCAGCACGCCTCCTAGATACGGCGT
CTTCTTCTTGAAGTCGTTGCCTTCCTTGAGCAACTCCTGCCGCTGCCGCATCTCGTAGTCGCCAGCGCCGCAGCACACATTACCCAT