Description :
From Genome Similarity Track
Location :
Scaffold_1:329171- 343071
Transcript NameFunction/comments
g105.t1POM63328.1 Glutamine cyclotransferase [Phytophthora palmivora var. palmivora
g106.t1hypothetical protein
g107.t1OWZ24685.1 hypothetical protein PHMEG_000208 [Phytophthora megakarya
g108.t1hypothetical protein
g109.t1RAW37441.1 hypothetical protein PC110_g6308 [Phytophthora cactorum
g110.t1XP_009515504.1 hypothetical protein PHYSODRAFT_477864 [Phytophthora sojae

Sequence
13900 bases(100 bases per row)
CCTAGGTTGAGGCTGTCTGGACCAGGTGCCCGCCCTACATACCCATACTGTACACATGGCAGGCTCGTGGAATTGTTGAATTGTTGAGCGCATTGTTAAG
TGCATGCCCTCGTGAGCACGTAGTCGACGTTCCGCCCAACAGTTGCAGTCTCAGGAGTCTCAACTCGAGACTCGAGTGGTTTGAGAGCTCTGCTCTCTAC
GCGCCAGTGGATCTTTTTCTATCGAGTGCAACGAGCACAACGTGCGCTAACGAAGAGGAGGGGCGACAAAAGAGACTTCATTTGACTGAGAGGCATCGCA
AACGCCAAAAGCGTTTGGTTTTCAGGAAACTTTGCTTTGAGACCAGCCAGTTGCTGTGCATTCGTTGTCAACAGGCAAGCTCCAATTGATTTTATACCGG
ATTCCATATCTAATCGCTGATAAATGAGCAAATTTATGCAATGACGCAGGCTGTTTGCCTTATTTTGTCCCTGTTTATGAGTCCATCTCTTTCGCCATAA
GCTTTTCAGTCTGCAGCTCATGCCCAGCCTCCTCCGCCCTGATGCTCGCTTGACGCGCCCCATGGTTCCCGCGCTGCTGCTGCTCCTCCTCCTTGCGAGC
CTGGCCTGGTTCAGTGTCGCCACCGCGACTGGCGATGGCGCGCCCACAGCTGTGCGCCTCGTGACCATCCACCCGCACAACGTCAGCGCCTTCACGGAAG
GGCTCGTGTTCGACGGCGGCGCCATCATCGAGTCCACGGGCCTCAACGGGGCATCCTTCATCCGCGAGTACAAGCTGGCAGACCTCCATCCAAGCTTCTT
CAGGGAGGGGGCATCGCACAGCGTGCCGCTCCTGCGGGAGTTCCGCTTCGACGATGCCACCTTTGGCGAGGGGGTGACCGTGCTGGGCGACAAGCTGTTC
GCGCTGACGTACAAGGCGCAGCAGGTGCTGGTGCTGTCCCGACACGACTTCCACCTGATCGGTCGGTTCCCCCTCACGACATCTACCAAGGAGGGCTGGG
GCCTCACGACAGACGGCGAGTTCCTCATCGCCAGCGACGGCTCGGCCAACGTCTTCTTCTTCGACCCGCGCGACGACTTCTCGCTGCACCACAGCATCAC
CGTCCGGAAGAACGGCGTGGCGGTGGCCAATGTGAACGAGCTGGAGTTCGTAGAGGGGGAGCTGCTCGCCAACGTGTGGTTTGAAACCCACATTCTGCGC
ATTGACATCGCGACCGGGGACGTGCTAGAGCAGATCGACTTGGATTGGATACCCAACATGGCAGCCAATATCCATTCCGAGGCAATGAAGGTATCCCCTT
ATAAGACGGACGCTGTGATGAACGGAATCGCCTACGACCCGGTGACTCGCCACGTGTTCTTGACCGGCAAGCTCTGGGACTCCATGTTTGAGCTCGAGCT
GTCATATCTTAATGCTCACCGGCAGTCCATTGTCCCTTAAAACGCTGCGAACGAAACACCAGTCAAACCATGGCTTGGTTTGCAGTGAAGGGGTAGAAAA
TGATTAGACCAACGATACATGTATTCGGCAACTATGTAAAAGATACGACGACGACATCGATACAAACATCGGTACGCCTGCTTTCGTTCAGCAGATCGGC
GTGGAGGGAGAGTTGAAGTAGCATTCGCTTACGCAAACTTCTCCGAGTGGAAGTCAAACATTGTGCCGTCAGCACTCGACGACGAGTACCTCTTGCACAT
GTTGTTCAGCACCTCCTCCAACTCGTGGGGTCCACAGCAGAACACACCGACTTCCTCGCCAGGGTGCATGGCTCTAGCATCGGAGAAGATCTTGTCCCAG
TCCGGGCGGCCGAAGTGTGTGAGCTGCTTCGTGTGCATCCCGGAAACGATGTCCTTGCCAGTCTGTTCGTGTACGAACTCCTGAAACATCTTAAGCTGGG
ACGTGTTTTCCTCGCCACCGAGCACAACCGTACTCAAGTATTGGTGCGTTTCAATCACATTGTCTCGATCCATCTCGGCGATCTGATTCATCGTGCCCTC
GAACCAACTCAGAGACTCCTGTCCACGGGTCACCCAGTGGAAGTACAACTTCTGGATCTGGAAAGAGCTCGGGTGGCGAGCATGGTTGCAATTCAAGCAA
CGGTTGTCCTCCCACAGATGAACCACATCCTTAAGAATCGAAGCGAACGGGGTGACGCCGATGCCACCGCCAATGCAAATGACGGTCTTGTAGCGGTGGT
AGTCCTGCGTTGGAGCACCAACCGGCCCATCAAGATACACATCGGGGTACTGCAGGTTGCACGCGTGGCAGTCCGCAATCACACGAGCCATAGCATCCGT
CCAGTCACCGCAGACGCGCATGTGGATGCTAATGTAGTTGTCACCCGGAGCCGATGAAATCGTGAATGGGTGCCACTCATGGGATGAAATCTGAGGGCAG
TTGATGTACAAGTACATGCCGGGTCTGTATACGAACCGACGGGGCTTTTCGATAAACAGCGCAACGGTGCCATCCAGCTCCACAGCCTCCATGATGCGGA
CTGGTGCAGCAAACATCTTGGCGTACCGGAAGCGACGCTCAATCAGGTAGATCAGGAACGGAGGTGTGATCCAGATGTAGGCTGAGCAACGAGCAAGCCA
CGATGTGGCTCCATGGAATGCCAGTACAACCAGAAATGGTCCGAAGAGCATGTGCGAGTACCAGAAAAGGTTGAACTTGCCCTGGCGGAACTTCGGGATC
GCAGCAAGAGGGAACGAGATACAAGTGATGACCAGAAGAATCACGCCAGTCCACACTGGAAGCGCTTGTAGCATAGTGGTGAACGGAGGTCGCTCACCGT
TCACAAACGTCGAAACGTGGCGAGTGACGAAAATGGATCGCTTGACCTCGTCCGGCGTGGCGATGAGGTACAGGTAAATCTCGTTAAACACATGAGCGAT
CGTGTGAATGAGACCGGCAATCAGCAACACACTTCCCGAGATCTTGTGGAAGGCAATGTGATCGTCGAACGGAATGATGCGCCACAAAAACTTGCTGCGC
TTCATGACCTGCGTGATGGAGCGACACATGGGCAGCAGCACGAACACGCAGTTAAGCATGGCGACCTGGGCATTGGCTCGGGCGATACGAAGACCCCAAC
CGATGGCAGGATCAACCTCGTACATGAACCATTTGACCCAGAAGGCGATGTTGTTCACGATGACGTAGAACAGAAGCCACCAGACACGCAGCTTGTTGTC
ACTGTACCATTGACCGAACTTGCTCTTGGGGCGAATCGGAGCCGAGTACACGGGCTTGGCCTCCTCGAGGTGGTAAGAGTCTGTCACGTACGGCTCGAAC
ACCGCGCAGAATTGTTCAAACGTCATTGCGTCATTTTGAACTCGTGCCTTGCGGAACATGAGCTTGGCCACTGCTTTCAACTCCATGCCCACCACATCAA
TATGAGCACTGGAAAAGTTCGACTCCAGTAGCTGAATGATTTGATCCTCAATCACATAACCGGTGTTGTCTGGGTCCAGTGTATCGAAGATGAATCGCAA
CTTCTGCTCGGCATTTACTCCGAGTTTCATCACGGCGTCGATCAGAATGGCATTTCCGTCAATAGTGCCGGTGCTGGTAGCATACCCATCGAAATCGTTG
CCGTCCACCTCGAAGGCATTCGAAAAGGTTTCGCGCTCGATGTAGCCATCCTTGTCGGTGAAGTTCCCCATCGCATCACGAAGCGCCTCCAGCTGCTCCA
TGGGCGTGTACGCCTTCTCATCCATGCTCATGGCCACGTTGTATTTCTGCTCGAAGTTGCAGTCGCCAGGGATCGGCACGGTCACAACATCACTTCCAGG
AGGTGGGCCGTACATGTCGTCCTTACCGGCAGGTGGGGCAATGCGGCATTTCTTCCGGGCGGCGTTGGAGTGCGACGAGACACTCGACGTCGACAGTGTC
AAACTTTGGCGAACCATGTTTGAACGCATCATGGCGTCCACATTAGCGCGGCGACGATGCGAGCGCCGGTTGGTGTTCCTGCAGTTGCCAACCGCATGGG
TGCTGGTTGCGTTCATCGACATGAACTTGCTGCTATCCATGAAGTTGGCCGTCGCCGGTTTTCGGAGCGGTGGGTTCTGGCTCATGTTGACCATTGTCGT
CGTTATTGGGGTCGTTTTGTCACCAAAGCGAGGGGCATTGGGCGACGGCGTGGAGACGTCAATGAGTGCCTGCGTTTTGGCTGGGGTGATTTTCAAGTCG
TCTTTAGGCTTGCCACGCCCGGGTTCTTTTCGTGAGCGGTCCATAGTGGTCGAGACACCTTCGGAGGCGGACTGCAAAAAGCAAAATGGAGAGTGGGCGC
TACCGACCCGAAAGCTCTCACTTGACACTTCATTGCCGCCACCACAGTGTTTGCCGTCGATGGTGAGCAAGGAGGGAGGTGGCTTGCACGCAAGCTCTGT
ATGTAATTCGGACAACTAGAAACGCGCACTACGGCTATCCTCCAAGTAAAACAGAGCTCGGGTTCAAGGCGCGCCCCGGGAATTGGTCCTCTACCTGCGA
TTCACACGGAGACGGTCGCCACTTCGGGCCGACAACTATCAATACGTGTAGTGCTGCCCATTTGGGCAGATCGTGGTGCTCGTGGCGTCGTGCACATAGC
GACGCAATTACTATACTGTAGCGCTCAATCGCAGCTCCAGACTGCTATTGTGCTATCAACGCACCACCACAAAAGCTTGGGGTGCGGTGTGCCGCACTCC
GCGGCAAGCTCAGCCAATGTTGTATTTTAATCGGTCGCAACTGCGATTCCGGGGCCTCCAGTTGACGCTCGTCACCGAGAGACGCACCCCTCCCCACTCA
ATCGTTCTGTCAGTGAGCCACGGAGCGGGGCGATCTCAAGATGGTCAAAAGCTGTATCGACAACAACTTGCACCTTAAATCGATGCAAATGCCCCGTTTC
GCGCGATTAAATTGTTGCCGCCCGGGACAACCTCGTTAAATGCCAGAAACACGCAGGACCCGCTCCTTTTCTTGCGTTTCCTCGAGCACAGCCGAAGATG
CCCATGTAAAGATGTCCAAAGCGCGTTTCTATTATTATAGACTCGGCGTTCGAAGCACCCTCGGCAAAGGTGTCTTTGGTCGCGTCGACAACCTGTGCAA
ACGGCAAAGAGGCACGAACTACTCTGCTTGGGGGCTGTTGATTTCCCCAGAATCTGCTATGATGCATTTCCAAGCCACGGTACACATGTACAATATGTAC
AATATGTACGACGTACAATACAGCTGGAATAGTGGCGGCCGACCAGATACCCTGACTGCATTTCGGTGGGGTTAAACGTACCGGTACATGTACAAGTGCT
CGGGTGGCGCTACTGTAGTCCAGTCAAAGTAGTGATTGCTAGTAGCAATTTACGTCGAACGCCATAAACACACGGCGGATCAGTCGAAAGGTGAATCGGA
AAGCATTCAAGGGGACGTTCATCATACATGTACTGGCATTGCGTACTGGAGGCAAGAATTATGAGAGCCTTCGCCGCAACCAAGAATTTGCTAGAATGCT
GTTCGGTAACTCAACTGAGGTGCACGATGAAAGACCAAAATCGTTAACTGTTCAATTTGGAGCTCTCGCATCAGGCAAACCGTAAGCGCTCACTTCGAAA
GGACTACGGTCCGGTCGATTTGGGGAGTTCCTATCACGACCAGAAGACTTTGAGGGAGGCAGCCAGAATGCATCGCTTGGTTGGCGAGATGAGTAACGGT
ATGCCTGAGTAGGTGCCCGTCGATCATTTTCTGGTCGACTCGGTGGCGACGCACAGCTATCCGCACAGGACGACACGCCCGGATCAAAGTCAGCTGATAC
TTGCCCATTGCTACATATGTAGCTCTGCTCATCGTCTCCGTCGTCTTCTTCCTCTTGAAGTGTCAGCTCGTGAATTGTAAGAGCTTGCTCCTCAAGACGC
TTTTTCAACTTCTGCCGCTCTAGCTGCAATGCTTTGATTTCCTGCCGGAGTTCGCCCTCTCGTTTCTCAATATCACCGTGCCAAAGAACTCGGTCTCCTC
GAGACTCAGACTTCAATCGGGTCACTTCTTCTTGTAACACCTCGCATTCTTGACGCAAGACAGCAACCAGACTACCGGTAACGTGATCGGCAGGCGGGAC
GCCACGATCGGCTAGGCTTGTGAGCGCCTCGGGTGAGAGGGGTGATTCAACGCGATTCGGTGACAATTTCGACTTGGACGGGGATTCGTTAGCCTTCGCC
TGCAGCAGATCATCTATCGTGTGAGCCTGTTCCTGCATGGAAATGAACGAAGAAATTAGAGTTACTGTCGCTAACAGTCTTCCACGATAGTAGCTTTAAT
CGCACCTCGATCAGTAGGTTTGCACTCAACTGCGCCTCAACAATTTCATTCCAATGCTTTGATTTTTCCTGCTTGAGCAACTCGTACTGCGCGACAAACT
CCTCGTATCTCCGCGTAAGCTGCGCGTGGTCTTGGGCTATAGAGGTTTTGTCTGCTTCGAGGCTTCGAATCTGCTCCGTCAAGGTTTCATGCTACACAGG
GAAGAAGGTTCAGGGTCTCCTTCACACAGCCAAACACACTTAAAAAAGCTAAAGTTCCACTGACCTCTTCCAGTCGAGCAGCTTCGAGTTCTTGAAGCTT
TTTACTCTGGTCTGCGGTCTGCTCACACACGTAGCACTTAGATCCAGGCCGACATCGTGCTCTTCCCCACCAATCTACAAGCCCGCTCTTTAGGACAACT
ATCTACTTACCACAGTCGTCAGGCTCGTCAAGTTTTCTACCAGGTCTTGCATCGTTTTCTTAGTCCCTTCCATTTGTTGTGCCTCCTCATCTCGCTTTGA
ACTCACATCGCGTACCTTGACTTGGGCTTCCTTTAGCATGCATGATAACTTCTGTTCTGCTTCTTGAAGCTCGTCGTGTTGCTTTGTCACAGTATTGTAT
TTACTTCGAACCACCTCGGACTCCTCGACAGCAATCTGGAGTTGTCGACACGTATCCAAGTACTTTGAGTTCACTTCTTGAAAGCGATCCCAGCGCTCGA
GTTCCATGTTCTTCGTAACTTCTAGTCGGGTTTGCTCACGAACTGCATCCATCTTAATCACCTCTTCTTGCTTTTTCTGCTCAGGGGTCTTTAAGCATTG
TGGACAGGTGGCGCTAATCTTCTTGTGTTTTTTCTCGATTTCCCAGCATTCCTCTTCTTTGCCCTTCATCGCCTGCTCATGCCGCAGTTTCATTTGCTTC
ATGGCCTGGTAGATCTGCTCATTCTGCTGTTCTATACACGTTCGCGAGCGGAACAACCCGTTGTAGTCTTCCTGAAGCATGGACAATTGCTCTTTCGAGT
GCTGATGGTTGCGCAGAACCTCCCGCCACTTATCTTTCATGTGCTTTATCATCAGCGAGTGCTCAGCCTTTAGCTCACTCTTAGCGTGCAGCGCTTCCTG
CAGGGCTGTCGACAAGTCTACCACCTTCCGCTTGTACATAGTCACCTCGGCTCCCATTTTCTCCTTCAACTGGAAGCTAGATCGTTCGCGGTACCGTGCA
TCCTGTAGTTCCTTATCGACCAGCTGCAGTCGAGTCTTACACTTTTGCAGTTCGTCCGCCATTGGGCGGTGCACATTCTGCCATTCCTTCCGCTCACTCT
CCAACTTGCCTCTTAGCTGTTCCACCCTAGCTCGCAACGCCTGGCGCTCCTCTTGAGTAGCGCGAACATTTGCCGCCGCCTCATTTTTCACTACTTCGAC
GGTCTCCTCGTGTTTTTTCTCGCACGTGCGCAGCTTCTCGCTTAGACGGCTAAGTTTGGCTTGGTCCTCCTGTCGTTGGTCCAGTGCCGTCTCAAGCAGG
GAGCTGGTGTGCGTGAATTGACCTTGGAACTTGGTACGTTCAGCTTCAACCGCCGCCGTTGCAATCTGCATCGACGCGATCTCGCGCTTGAGCTGAATCG
TGTGCGCACTTGCTGCAGCCGCCGAGCGAGCAGCACCCTGGTCCTTCTTCACCAACTGCTGCCGCAACGTTTCGAGATCGCGCAGGAACGAACGACGCTC
CTGGTATTTTACAACAGACAAGCCCTTGTGAGCATAGATGGCTACATTTGACTCAAACAGCCTAAACATGAACGCCTTCAGTTTGGTGTACCTTGTCAAA
GCATCGCTGTGCATCCTTCAAGGACAGCGTGGAGGCCGCGGCCATGGCTTCCTTCGCCATCTTGACCGGGCGAGGTGGGTAAGCACGTAGTGCCCTCCAG
ACATGCAAAGTGCGCGGTTTACACAGGCTAATCCTGGCTTAGCGTTTTGAATTCTCAACGACCTCTATCAATAGATAGTCTGTTTCATTGAGTTCTACAA
ATGTCAAGTATATTACCGTAAAAGATTTCACATATCAATATCCTTGCAAAGTAGATTGAACATTCGCGGTCGGTTTTTAAACGACGATATGGAGTGGTGC
ACACAAATAAAACAGTGATGCATCGACAAAAGTGTCGTGCTGCAAAGCCCACACAGTCTACGCTCCGATGGGACTGCGTCTTCGCCAGTTGCAGGTGGTT
CACCGCCACGGTGATCGCACCCCATTGCTCAACATCTTCAAAGGGAGCATCAATTCTCGCTCAGAGGAGGAGGAGGCGCTGCTATGGGGGCGGCAGCTGC
CCGAGGCCACGCAACTCGCGCATATCCGTTCCAAGTTCAGCGTCCACTTGGGTGGAGACGCGCAGAGCTCGTTCCAGCAGCGGCCGTTCGGGTACTTGAC
GACGCGAGGCATCGAGCAGATGACGATGCGTGGGGACCGACTGGTGAGACGCAGTTGAATGACTAGGATATGCACCGGGGAACTTACAGATGACTGTGGC
AGCGAGAGTTTTGCAAGAAAGAGGAATTGCGGCTGGATGAGGTGACGCCTGAACAAATACAAATCTTTAGTAATGCGTACACGCGCACCCAACTTAGTGC
CCAGGCACTATTGGACGGGCTGCTGCGTGACCAGCCACAGTTGACTCCTCCAGTCAGTGTGCTCCCACCGGAAAAAGACATCATCAACAGTGCGTGCTGA
AATTGCTCATTGAGCCACAATGGTTCGTGCTTCTCCTTGGAAACAAACTGACTGGAATATTGATTATGGTATTATTGCGGGGATTGGTACGATCAGCGTA
CGGAGTTTTCCCTGAGATTATGGAAATGAAGGCGGCCATGGAAAAAGACAACGCTGAATTTGCGGCGCGCGAGCACGAAATGGCCCCGGTCAAGCAAGAG
TTGATGAAGCTGTTTCCGGCTTTTAACTCGGGTCTAGTTCCTTTTTCGTGGTTGACTCCGGCCGACTACTACGTTTGCCGTCGTGTTCACCAGGCCCCGT
ACATCCTTGGCACAGAGGTTCACGGTGAAGCCACCGAAAGACACCTCGGCTTTCGTTTCCACCAGGTAAGGATGACCAGGGATCAGCCTTGGGTAGTGAA
TACTGACGGAATGTCTATGATGTCTGCAGTTCTACTCGCATCGGACGATCCTGAAACTCGTAGCCGGACGCTTGATGCACAACATGCTTCGTGAGGTAAT
CCAAACGTCTGTTCACGGGGACGCATGCAACACTGCTCTTGACAAAGTGGTGGATCGTTTTCTGACTTGCAGATGCAAAAGGCGCTCTGGGAACACAGCG
AAAGCAAAAAGCTCGTGATCTACAGCGGACATGATGTATCGCTCTTAGCCGTTCTGCGAACGATGGACGCCGAGATCACCAACAACATCGACTGGTGGCC
TGAGTACTCCTCAGCTCTTGCACTCGAGCTGCTAGAAGACGAGAACGGAACATTCTTTGTTCGTACTCGACTGAACGGCGAATTTCTAGCGATAGGAGAG
TCTCCAAACGGCCTTTGCTCTCCTGATCGATTCCGTGACATTGTTGTGGATCACATCGGAGACCACGTTGATTAATGTTAGGCATTCGCAGCAACAAACT
GCGGCCAAAACCAAAGCAGCAACATGGGAAAAAGGTAAGCAAGAATAGACTTTTTGTTTCTAGAAAAAGTTTTACGCCAGCAGCTCCGCGACTTGCAGCG
CTCTCTTGTAACGCCGCCGAGCGAGCTTAATACTGAGCATCTTCTCCTTCTCCTCCGCCGCAGCTTCTTCCTCTTCTTTCGCTGGAACACCAATGTCAAT
GACTCCTTGCGCCGACTCCATCACACGCTGCGACAGAAAAAAATCAACCACCGGTCAGCAAAATCCAACAGTTCTACCACGTTCTTCACTACTGACCTTC
CGTGCAGCACCTTGAATACCGTTGAGGTACTCCAGCACAACGCTAAACATGGCCTTGGGGACAACGTCAGCCTCGTACATCCACTTAAGGATCCACTGCT
GTTTGATTTTCTGCAATGCCACAAATAAAAGTAGTTAGCGACAGCAATCCTCATACTCTGCTGCTTTCTCCGACAACGGACAGTGAGTCGTTCAACGAAC
CTTGAACTTCCAGGGCAGCTCGTCATCAGCCTTGGGCTCGTCCCGCTTCTGCCACTGCTCCAGGTAGTACTTGGCTTGCTGGATCATCTCCGGAGAGCGG
TCCGACTTGCCGCCGCCCTCCTTCACCTCCTCGGCATCCTTCTTCTTGAAAACTCTCGCGCGCTTCTTGGGCACGAGTTTGTCCCCGTTGTCGTCGAACT
TGACGTGCGCCTGTACCGTCTCTTTCTTGGTCTTGGAGGCTTTTAGCTTGCCACGCTGCTTCTTGGACGGCTTCATGGCGCCCATGATGCTCAATTGGAC
TGGTTGTCCTGCCAACCAAATTCATGCGACGTGTAGGAATGAAGTGACGCACATCAACTCCAAAACGTTCTCTGATTGGCGGAACCTTAGCTATCTTAAC
TCTGATTCGTCGATAAATCTGCCGAGTTTGAGCTCGAAAATCGAACATGAAACCGCGGGGAAAATCGTAACGGCTGTATCTATCGGCGCCAAAAATCGTC
AATGAGCTCCAAGATGTAGACGCAGTTCTCTTCTTGCACGGGCATCGAGCAGCGGTCCCGCCCGTTGACCTTTCACTGTCACTCTGCTCTTGCATGCTCC
CTGGAATTTGATAGAGTTTCAGACTCAAGAGAGCGCCCGTTTACTGTGGAATGTGCACCAACCGCAAGCGACCTCGCTCGGAGCAGGTGCCGGTGCGCAG
TCCGCCCCCGACGAACCAGCAGCTCCACGCCGATGACGACCAGCTGAAGCGCACCAAGACGGAGTCCCCGACGTCCGTAGACCGCGTCGGATTTGCAGAG
GACCAGAATCAAGCACAGGACAGTGAGGAGCTCGCGACGGCTGCGCATCGAGACGAGATGGTGGCGGCTATTCTGACCATCACGTCAGCGCTAGGGCTCT
CTCGAGAGACGCTGCATGTGTGCGTGGGGTTGCTAGATAGATTCTTGGCGCTGCAAAGCATTGAAGCAGCTAGACTCGAAGCGTTGAGCATCTCGTAAGC
TGAAGAGCTTTTGTGGCTGAAGTTTGCAGTTGGGACAAACGAGTACTAACCGGAATATGTGGGACTTGCTGGTTGCTGCAATTGCAGGTGCTTGTGGATT
GCCGTCAAGTTTGTAGAGACACCGACGACCATTTATGATGAGGGCATCAAAGAAATTCTACAGCGTCGGAGACTCTCCAGCAATGTACGTGGAAGTGTGT
CTCTTGTGCGCGATATAGACGAGATAACTAATGTTTGTTTCATTGCTGCTTACAGTGGACATGGAACGAAATCCTCGAGTATGAGCTTAAGATTTTGCAG
CTCCTCGACTTCAGAATCATGGCTCCTACTATTCTTGACGAGCTGCAGAAGAAGCTTTACCGTCTTCAAGATGAAGACGATAACAGAGCTGACGCCCTCC
CTTTCGAACAGCGTCAATTGGCGTTGTACTTTGCAGACTTGCTGCTTCTCAAGGCGCGAGCCAATCAGTTCTCAAAGGATCTACTTGTAGATGCCATTTG
GTTTGTGGTGTCCGGTAATCAGATTGCTGAAGTGAAGCCGCCCATGCTGGAGCCTGTGGTGATGCTTTACCTTGCGCACCGCGACAACATCAACCCGAGT
CATTCAGTGTTCAAGCCATGGTTCGCGTTGCGCTGTCGCTATGGCGCCTTCCTACCCTCACCGTGGAAGGTACCCTATGACCCATCTTGTGTCTGCCGCG
TTTGTGAGCACGTGCAGGAAGAATTGGCTTCTTGATTTAAGCTTTGCCGCGGCACCACTCCAGTACAAATTTGTTGAGATCTAATCGCATTCAGGATATA
ATAGATGTACCATACCGTTCCCTCCCAGCGTGTTGTGTTGCTCAGACATGTTTTGTGGAAACTCCACAGAAATGTTAAAGTCCAGAAAACATGAATGCGA
AATACCATTTGGCCCCAGGCGATTCTATCTCCTGGCTGAGTTTGCACGTTGCCGTCTCTATTGTGACTGACAGACGGCGTCTAGCACCGGTGCACGTGAG
CAAAGATAAATCTTGAGAAAGACGTCATTTCCTTACAGGAAGTGCGTCTTGCGAAGGTCCTGGTACTTCTTGTAACCGGCAGCAACAATGCCGGCGATGA
TGAACACAATGATGAAGAACGGAGTCTTCCAGCTACTGGACTTGGCCGCCGTCTCCTTCACGGTCTCCTCTAGCTGCGTTTCTACCTGGTCGCGGATGGC
ATTCACGGTGCTGTGCACACGCTCAACCACTTTTCCGTTCGCCCAGGCCTCAAGCTCATCGATACGCTTCTCGTCCTCAGCACCCTGCTCCTTCAACTTC
TGGATCGTGTTCTCCGTGGACTCCTTCAGCGCAGTAAACTGGTACTCAAAGTCTTCGAGCAACTGAGCGTACTTCCGCTTCACCAGCTTCATCTTGTCGT
CGTTGCTGCCCTTGCTCAGAGTAGCTTCCAAGTCCTTATCCACGGCATTACGCTGCTTCTCGTCCTCCTTGTCCGCGAGCGAGTCGATCACATCACTAAA
ACAACACACAAACATCAACGAATAGTTAGCCCCACCATCAACAATAACCAAACTCACCGAGTACACCAACCCAACGTACTCGTAGATGTTGAACGCAATG
ACGTCGTGGTTGTCGGCCAGCCCACCGGTAGAGGCCGAAATTCCGACGTACGCGTCGTTCATCCAGTCGTCGCCAATGTTCAGCCGCTGGCTGTAGCACT
TGACCCAGTTGCCCGACGCGTCCGCATCGATGAGGATCGTAATCTGCTGGTCCGCTTGCGTGTACGTGATCTTGGCACGGGACATGTTGAGCGAAGGACT
AAAGGCCGCGTTCTTCTCGTGGTAGCGGATGCCCGGCGCCATACAACCGACCTTGTCCATGTCGTTGAGGTCGTCCAGTGTCTTGGAGCCGTCGTTCTCG
AAGAACGTCACGTCCTTGTGCCCGCCGCTGTGCTCCTGGTTCACGAACGTGTCGAACACGACGCCGATACCTTTGAAGTCCCCGATAAAGCCGTGGTTGC
CTCCCTGCACGTACTTGCTGGTGGTGAGCCATAGCGCCAGGCCGTCGCCAAACCAGGCCTTAGCCTGGCCGCTGATTCGGAACGTCAATACGGCGGCAAA
CTCCTTGGTCGCCAGCTTCTGCGAGCCCCAGATGTGGCCGCGCTTGCTCTGGCGGTCGGGCGTGAGGCGCGCGAAGTGGCGGTTTACGGCTGTGTCTTCG
CCGTACACAAAATTGTCTCCGATCTGGCGCAGGCCCTCACCGTCGATGTCGTCGAAGGGCTTGTCGAACGAGGCGTGGTCCAGACGCTTGCCGTTCGCGG
GAGTGGACTGCAGCGCTGCGAGAAGCGTGGCCACACAGAGCAGCAGCCCCAAGCTCATGCGCGAGACTCTCATGCTCGATGGAGGGAAGACAGGAAGTGC
TGGCGTCTGCCTCGGACGATTTGCTACGTGGCAATGATCTGGACCAGAACTGGACCAAAGTACCGTGATGGAAGGACTTAAGTGCGATTTAGAGCTGGAA