Description :
From Genome Similarity Track
Location :
contig_48:329121- 332125
Transcript NameFunction/comments
g10307.t1XP_009518315.1 hypothetical protein PHYSODRAFT_555752 [Phytophthora sojae
g10308.t1RAW41572.1 hypothetical protein PC110_g2211 [Phytophthora cactorum

Sequence
3004 bases(100 bases per row)
CGCTACGCCTGCAATCGCGGCCCAGAAAGAGCGGCGCACCTGTACCATTTTACGGCCCACCAAACAGCGACGGTGTTCTTCTGGACTGCAGGGGCAAAAG
TCCCGCGTTTCTCGTCAGCCAACGCTGGTGTCGCAGCGATATCCATAGCCGCTCGCATTTCAAGTTGCTCAGTTGCATAAGTGCAAGTCCTGACGTTATC
AACCGCACTGAACGGAGATGCCTGCCGAAGATGGTTGCAGTGCTCTATTGTCGTGCGGTGCTGCTTTGAGATCGTGAACGAATTCGGCGAGGGCAACTCC
AGTACAAGTCCGCGATCTTGTACTTCAATAGACCTCAAGTTGGTCTATCCCACGAGCTCTTGCGCACGATGAGTGCGGCAGGCACATCGAGGGATAGTCC
ATGCTGGTTATTCTTCACTTCAAGTCGCGATACATGTATGCAAATGCTGACAGCGCCTCTATGGCTACTCTGTCGAAGGAAGAGTTTCACATTGTACAAT
GGCGCTCTATATGAGCAAATGTATTATCATGAATAACGCCGCGAAGCGTTGTCTTGTATCTGCATCTCAGCAGAATCAACATGTCAAAATCTTCCCTTGA
GCTATGTCATGTCGCCCGTACATGTACTCTACAGTGGTGGGAAGACGAATGCCAACTTAGACGACACGAATCCGTCAGCCTCCTCGCGAAGGAAGGTCAC
GAGCTCTCCGCGTCGTGTTGCTGTTTGCCGAGCCACGAGGTCGATGTCCACGGCGCAGACCCACTGCACCACATCAACCTGGCGGTTCACCATGGCCTCG
AGTAGTCCCTCAGTAGACACGAAGCTTGTTTCTACCATTGCTGGTGCTTGTGATGCTGCCGTCTTCGGTTCCGCCTGCTGGTACACCATTTGAGGAGCAA
CGGTAGCTTGAAGCCAACGCAGCACACGGAGCTGGCCGTATCCAGCGGCCGCGTCGGCCATAGCACCAACTAGCGTCATCTTGCGAGGACTGTCGGGCAC
CTTACGGAAGAAGGTAAACTTCTCGTGCAGCCAAACTAGAATTCCGATCTGCCCACAGCGCGCAGCAGCAATCAGCGCGTCGTTCCAGATTGTCAACCTG
CCCAGCTTTGCGTGTAGCTCCGACGCTGGCACTTTCAAAAAGATCTCGCAGTTACCACAGATCCACGTGACGACGTCCAGGTGCCCCATAGCGCACGCCA
CATGAAGCGCGTACTCGACGCCATGCCGCCGGAAACGCTCCTCGGTTCGCACAGGTTGAAATTTCAGGAACACGTACGTTAGGTAGGAAAACTGCCGGTA
CTTCACGCCCCATTCCACGATGGATGAATCCCCCATGAGCGTCGCACTGTGTGTTTGGAACCATTGAAGGACGTCTCCAGCCTTGGTATAGCGCATGATC
GCTGTGAATGTCTGGTGCGTGAACAACTGGGGGTGCTTCACACTGTAAAGTTGTTTCAGCACATCAAGTTCGCCCCGTTGAGCCGCCCACAGCGGCATCC
ACTCGAGATTTGATGATGACTCGGGACAGTATTGTACCGCGAGGCGGACGAACTTAGTCTGCCAGTAAGGGCTTGTCTTACATGGGAGCGCCCACGCAAA
AGATTCAAAACCAGCCCGCTTCTCATCAGTGTTTGATCGGACTCCAGCGATACGGGGGACACCTATGATCGGTCCGTCATTGGCATTCGCGGTCGTAATA
ACTGCTGCAGTAACAGCCGTCGTTGGTGGTTCTGCCGCCGCATTAACACCGCCGTTTAGCTCACCACTGCTTCTTCCTGAAAGAGCGGTGACGTCGATTG
CATCCTCGTCGGTGATTCCACGACCTACGACCGAGCGTAGAACAATTTCGCGCTCTTTCATGGACAGCGAGAACGTCGGTGAAGCCAGCCCGCGCTGCAA
TAACCACTCGATCATGCTGAAATGACCGAGTGAGGCGCAACGGTACAGTGTGCTGCCATCCACGATGTTTACCGGCCGAGAAGATTCCACTGACGTGAGA
TTATCATATGACGATCGTCGTTTGATTTCCACGGAAGACAGGCCCGGCAGCATAGCGTCAATTGCGTTGGAGGTAGCAGCACGATCTCGACGCTCCCGGG
GCAGTTTCAATTCTTTCGCTTCGCTGGAGGGGCTATCTGAACGTTCTGCAACCCACTTCGCCATCTTGACGTTTCCGTCGAGGCCGCAGCAATGAGCATC
TGTGGCGACCAGAGCCCAAGTTGCTCCACTACAAAACCAGTAATGCTAGATTGCCGCTTGCTGCTGCCTTCTCGGCCGCGGTGGGAGACAGCGAGTATCT
TTTCTCGATGGGAATACGCTCGGTAATGTACTTCACAAGCTCCAAATGCCCTGATCCAATAGCGGCCTCCAGTGTGCGCGGATCCAGCGGCATCCTCATG
TCTTTATGCAAATACTGCAGCGTCTTGATGTTGCCGTGAGCTGCAACGCTCGGTAAAAATGCAGGGGAGCACGAAAACCGCGGGAAACGAGGCACCAACC
AGCGGAGCACGTCCGCATGCCCATTAGTCGCCGCTAAGTCTAGCACCAGCGAGCGGCATCCGTCACTGCTGCGATGCTTGTGTAGCCACTGCACCACCTC
CAAATGTCCATTTCCTGCCGCGCTACACATTCCAATGGCAGTGCCTCCTTCGCGCCGATTCTCATGGAGAAACTTGATCACTTCCAAGTGTCCGTTCGCC
GCCGCCGTGTCCATGGCCATACTGGTGCACGGCCACCGTCCATCTTCATGCAGCGTTTTCACCATAGCTAAATCTCCTTGTGCCGCTGCCGTATCCAACG
CACGGTAGCGTCTTCTCCCCAGTGACGTGGCCAGAGCTTCCGCATCTTCCCACGGCAGCAAAGGGTCTCTCTGGTCGTAGACACCAGCCAGCAGGCCTGC
TCGCGACGCGAAGACTTCTCGGAAGCACTTGCGTGCTGGGAACACCGCGACCCAGTTCACCACCTGCAGCTTGGACTCCAGTGGCTGCACCATGAACACA
TCGA