Description :
From Genome Similarity Track
Location :
contig_48:329118- 332122
Transcript NameFunction/comments
g9851.t1hypothetical protein

Sequence
3004 bases(100 bases per row)
AAAGTAATATTTGCCATCGCTACGCCTGCAATCGCGGCCCAGAAAGAGCGGCGCACCTGTACCATTTTACGGCCCACCAAACAGCGACGGTGTTCTTCTG
GACTGCAGGGGCAAAAGTCCCGCGTTTCTCGTCAGCCAACGCTGGTGTCGCAGCGATATCCATAGCCGCTCGCATTTCAAGTTGCTCAGTTGCATAAGTG
CAAGTCCTGACGTTATCAACCGCACTGAACGGAGATGCCTGCCGAAGATGGTTGCAGTGCTCTATTGTCGTGCGGTGCTGCTTTGAGATCGTGAACGAAT
TCGGCGAGGGCAACTCCAGTACAAGTCCGCGATCTTGTACTTCAATAGAGCTCAAGTTGGTCTATCCCACGAGCTCTTGCGCACGATGAGTGCGGCAGGC
ACATCGAGGGATAGTCCATGCTGGTTATTCTTCACTTCAAGTCGCGATACATGTATGCAAATGCTGACAGCGCCTCTATGGCTACTCTGTCGAAGGAAGA
GTTTCACATTGTACAATGGCGCTCTATATGAGCAAATGTATTATCATGAATAACGCCGCGAAGCGTTGTCTTGTATCTGCATCTCAGCAGAATCAACATG
TCAAAATCTTCCCTTGAGCTATGTCATGTCGCCCGTACATGTACTCTACAGTGGTGGGAAGACGAATGCCAACTTAGACGACACGAATCCGTCAGCCTCC
TCGCGAAGGAAGGTCACGAGCTCTCCGCGTCGTGTTGCTGTTTGCCGAGCCACGAGGTCGATGTCCACGGCGCAGACCCACTGCACCACATCAACCTGGC
GGTTCACCATGGCCTCGAGTAGTCCCTCAGTAGACACGAAGCTTGTTTCTACCATTGCTGGTGCTTGTGATGCTGCCGTCTTCGGTTCCGCCTGCTGGTA
CACCATTTGAGGAGCAACGGTAGCTTGAAGCCAACGCAGCACACGGAGCTGGCCGTATCCAGCGGCCGCGTCGGCCATAGCACCAACTAGCGTCATCTTG
CGAGGACTGTCGGGCACCTTACGGAAGAAGGTAAACTTCTCGTGCAGCCAAACTAGAATTCCGATCTGCCCACAGCGCGCAGCAGCAATCAGCGCGTCGT
TCCAGATTGTCAACCTGCCCAGCTTTGCGTGTAGCTCCGACGCTGGCACTTTCAAAAAGATCTCGCAGTTACCACAGATCCACGTGACGACGTCCAGGTG
CCCCATAGCGCACGCCACATGAAGCGCGTACTCGACGCCATGCCGCCGGAAACGCTCCTCGGTTCGCACAGGTTGAAATTTCAGGAACACGTACGTTAGG
TAGGAAAACTGCCGGTACTTCACGCCCCACTCCACGATGGATGAATCCCCCATGAGCGTCGCACTGTGTGTTTGGAACCATTGAAGGACGTCTCCAGCCT
TGGTATAGCGCATGATCGCTGTGAATGTCTGATGCGTGAACAACTGGGGGTGCTTCACACTGTAAAGTTGTTTCAGCACATCAAGTTCGCCCCGTTGAGC
CGCCCACAGCGGCATCCACTCGAGATTTGATGATGACTCGGGACAGTATTGTACCGCGAGGCGGACGAACTTAGTCTGCCAGTAAGGGCTTGTCTTGCAT
GGGAGCGCCCACGCAAAAGATTCAAAACCAGCCCGCTTCTCATCAGTGTTTGATCGGACTCCAGCGATACGGGGGACACCTATGATCGGTCCGTCATTGG
CATTCGCGGTCGTAATAACTGCTGCAGTAACAGCCGTCGTTGGTGGTTCTGCCGCCGCATTAACACCGCCGTTTAGCTCACCACTGCTTCTTCCTGAAAG
AGCGGTGACGTCGATTGCATCCTCGTCGGTGATTCCACGACCTACGACCGAGCGTAGAACAATTTCGCGCTCTTTCATGGACAGCGAGAACGTCGGTGAA
GCCAGCCCGCGCTGCAATAACCACTCGATCATGCTGAAATGACCGAGTGAGGCGCAACGGTACAGTGTGCTGCCATCCACGATGTTTACCGGCCGAGAAG
ATTCCACTGACGTGAGATTATCATATGACGATCGTCGTTTGATTTCCACGGAAGACAGGCCCGGCAGCATAGCGTCAATTGCGTTGGAGGTAGCAGCACG
ATCTCGACGCTCCCGGGGCAGTTTCAATTCTTTCGCTTCGCTGGAGGGGCTATCTGAACGTTCTGCAACCCACTTCGCCATCTTGACGTTTCCGTCGAGG
CCGCAGCAATGAGCATCTGTGGCGACCAGAGCCCAAGTTGCTCCACTACAAAACCAGTAATGCTAGATTGCCGCTTGCTGCTGCCTTCTCGGCCGCGGTG
GGAGACAGCGAGTATCTTTTCTCGATGGGAATACGCTCGGTAATGTACTTCACAAGCTCCAAATGCCCTGATCCAATAGCGGCCTCCAGTGTGCGCGGAT
CCAGCGGCATCCTCATGTCTTTATGCAAATACTGCAGCGTCTTGATGTTGCCGTGAGCTGCAACGCTCGGTAAAAATGCAGGGGAGCACGAAAACCGCGG
GAAACGAGGCACCAACCAGCGGAGCACGTCCGCATGCCCATTAGTCGCCGCTAAGTCTAGCACCAGCGAGCGGCATCCGTCACTGCTGCGATGCTTGTGT
AGCCACTGCACCACCTCCAAATGTCCATTTCCTGCCGCGCTACACATTCCAATGGCAGTGCCTCCTTCGCGCCGATTCTCATGGAGAAACTTGATCACTT
CCAAGTGTCCGTTCGCCGCCGCCGTGTCCATGGCCATACTGGTGCACGGCCACCGTCCATCTTCATGCAGCGTTTTCACCATAGCTAAATCTCCTTGTGC
CGCTGCCGTATCCAGCGCACGGTAGCGTCTTCTCCCCAGTGACGTGGCCAGAGCTTCCGCATCTTCCCACGGCAGCAAAGGGTCTCTCTGGTCGTAGACA
CCAGCCAGCAGGCCTGCTCGCGACGCGAAGACTTCTCGGAAGCACTTGCGTGCTGGGAACACCGCGACCCAGTTCACCACCTGCAGCTTGGACTCCAGTG
GCTG