Description :
From Genome Similarity Track
Location :
Scaffold_372:3291- 7138
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_372-fgenesh-gene-0.0Ankyrin repeat protein
Pytiw_DAOMBR242034maker-piw_contig_372-snap-gene-0.13D19Bwg1357e protein

Sequence
3847 bases(100 bases per row)
CGCCTCTGCTTCGTGCTCGGTATGCGCATGGAGCTCATGCATTTCCGATAGTGTTAGACCACTTATGATTTGTTTCGTACCGCTGCAACAGGGAACGTCC
TCAGTGCGGTCTCGGTGCTGCTGCTGCTCGTGGCGTGCAGCGAGCCCAAGTGGGCGTACGACACCGTCAACTCGGTCGACATCGGGCTCTGGTATCTCAC
GGTTCGTCCAAAAGAGCTCAAGTGTTGACAGTGTGTTAGTGGAGTCTTTATAGCGGGTTGTGCGGGTATACAGGGAATGGGCGTGCAGTACAAGCTCATC
AATGCCGGGCTCTCTATCGACAGCAGCGACGTTGCCTCGAGCCAGCAAGCCTTCACGATCTACAGTCGCTACTGGTTCGCTAACAAGATCGTTGGTCTAG
CTGTAGCGCCATATACATAGCGATTGATTTGTGTACTTTGCTTGCGCTGACCCCACAGCGCCATCCCGACGATCTCCGCGAAAGACCCGTGGTGCCAGGG
CCTCGCTACTTCAACGAGAAGTCTCACAGTCCTAGCGCTCGTGGCCGCGATCACGAGCTTCATCTTTAGCGTAATGGTAGCGATGGACATCAAGACGCCG
ACCTGGGACGGCGAGGGCAAGGAGACCACGCTTGTAAACTCGGTCGTGTGTTCCCTGTGCCAGGTCGTGTTCATGCTTCCCGCGGTCGTCTCCTGGCAGC
GCATGGTCTGGAGATACGACGCGCAGTGCCGCGCAGCCATGAAGATCGATAACTTCGCGTGCATCTCATCGTCGTCCTCGTACGTGCTCGCTATCGCAGA
CATCCCGTTCGCAACGGCAACGTACCTGCTCTGGCGACTCTCGCACTCGTACTATGTGAGTGGAACGAGATTGCGCTTGAGGCAGTTCTCACCGCAACTT
CTCTTGTTATATATGAGAAGCTCAATGACTCAGCATGCACACCTTGTTTCTGAAGGTGGCGAAGAAGAATGGGCAGATCGCCGACGGCTTTACGCTCGCT
GCGAAAACGGGTACTGGCGCACTGCGTGGCTCTTACTGGCGTATCACTGAACCATTTTCTCATTTGTGTGCGTGGATATAGACAACGTGGATGTGATCTT
GTCAGGGATTGTCAACAGCATCGACATTGACGCGATCGGCTCGGATGGCCGCAATGCGCTACACTGGGCGTGTACACTGAACCGCACGAGCATCTGCCAC
GTGCTGCTCAAGAAGGGCGCGTCGCTTAGCAAGAAAGACGTGAGGCTGGGCTCCTTTGCTAACTTTTGTCCTTGTTCACTGACAAAGTTGTGTATGTGAT
GCTTCTCTATTTGTAGCAAGACGGGTGGACCCCACTTCACTGGGCGAGTCGCGTTGCGAGCCTGGACATCGTGCGCTTGTTGGCAAAGTATGGCGCCGAT
CTGAATGTGCAGGACCGCTGGGGCACAACGCCGCTGATGCTCACGGTCGTGGGGGAGAATAAAGTGGCGGCAGCGACGCTTATTGAGCTTGGCGCGGACG
TCAACGCGAGAAATGTGAGCCTTGCGACTTGTGAGAGAGCGCATACCTGCATAATTCTAAGTCTTGTGACGTTTTGTGAGGACAGGTGTTTGGCCAGACA
GCGCTGATGTTGTGCGTTGAGGCAGGCAAGCACCTCTTCCAACTGGGGATGGTATTTCTCAACGCTGGCGCGAATCTGCGGCTCCAGGATGCCCAGGGCA
TGACCGCATTGCATTACGCGGCGTCCACTGGCAGCCTCAACATCCTGTTCAACATGCTCCAGCTCTGCGACGCAGATCTGGTAGACAAGCCCAGCAAGGT
TGGCCATGCAAGGACGCCATTATTTGTTGTGTGGAAAGCGTGATTTGACTCACAAGATTCAGCAAACCAATTTGTGGTGTGGTAAACACTGATAGTTTGG
CGAGACGATCTTGCAGCTTGCAGTCTTACGAGACCAGCCGATGGTGCTGGATCTGATCGAGAGCTGGCGAAGTGGGAACCCTGTTTCCTTAGCTGATGAG
AGGGACAGTGCTGACGAAGATACAGATGAGAGAGATGATAGCAGCAGCGGCGAAGACGATGATGACACAGAGAGCGACTGAGTTCGTGACCTCTTCAAAA
GGCAATATGCAAAAATCAAGACGAGCGAGTGAGAGAAGGATGAAAGGTGATGCTAGATGTCTATAAAAAGTTTACACGCACTCTACTTGAGCTTCTCGAG
CAGCAATTTCGTGCCCGTCTGCGTGTCCGCGAGCTTCTTGAGGCTCGGCAGCGAGGTCTTGAGCGCCTTGGCCACGACCTTCGTGGCCTCCTTCGCGCCG
TGGTCCGACTCGAGGAACGCGAGCACGACGAACGAGCCGCGGTTCGACGGCGCCCACGTGGCCAGGCTGTCCTTCACGGCAGCTAACAGAGGCACCGAGA
ACGCGGTCTCCTTGATCACGCGGCGCAGGCCCAAGTGCGCAATGGCGTCCGAGTAGATCGGCTCCTGGCCTTCCTCAGCTGACTCAGCCAGGACAGCCTC
AATCAAACTGGCCTGGACCTCCTCGCTCGAGCTGCGCTTAAGCACTTCCACGAGGATGTCGCGGCCCTCCTTGGATCGCAGGAGCTCAGTCATGTTGCCA
GCGACCACCTCCTCGAGCTTTGGCAGCAAGCCCTTAAGGAGCTCTTCGCGACGCGAGTCCGGGTCCTTCTTGTAGTTCACGACCAGCGTCGTGGCGTCAT
CAGAGGACGGCACCATTGGCGGCGCGAGGAGCTCCAGGTCGTCTGGCGACAGGTACTTCTTGTTCGCTGGGCTGAAGAGCTGCAGCAGCACCTTGCGGCC
CGTTGGGTGAAGCGCGACCGCCAGCAGGTGGTCGGTCATCTCCGAGAGGATCGACTTCTGCACGAGCACGGTGTCATCAACGACGTCGAGGATGCGCATG
ATCACGAGGTACCCACTTGGGTGGTTGCACGCGTCCAGCACCTTGTCCTTGAGGCACTTGATGATGCGCTTCTTGTCCTTGGGTGAGCCCAGCGAAATGC
ACTTGTTTACGACACGCGCACCGTTGCGGGTCGCGAGCAGCGCCAGCGACGCGTCACGGACGTTTGAAATCATCTGCATCACGTCGTCGTGCTCAGCGTG
GCACAAGTACTCCCAGAGCAGCGTCTGCACGAACGCGAGACCGAGCAGCTGCTTGTCGACCATGCGGTTCAGGATCGTCGCGAGGTGCTTGAGGACATCG
TCTTTCTTGAGCGGGTTCGCGTCCAAGATGTCCGCGAGGTTCTTCTTGTTCTCGGCCTTAAAGTACGCAAACTCCTTGCCGTAGAACTCGAGCTTGAGAC
CCGAGAGCTGCGCGGGCTTAAAATGCTCCTGCGCGTACTCCAGCACGTTCGCAGCAATGTTGTGCGTGCCGATCTGGACCGCCTGGCCGGTAATCTGCTT
CACGATCGTGGCGCGGTCCGCGACGCTGCCGTACTTGATCATCTTCTGCACGAGGAAGCAGCCGTATTGCATCTTCGCGAGGTCGATGATGTGCTCCTTG
AGCTCCGCGACGGTCTGCGTGCGGTGCTCCGGCTTGCCGTACTTGAGCAGCGCCTGGATCACACGCGACGCGTCGTGCTTGGCAGCGACGTCGTAGATCT
TACCCTTGACGAGGTCGAAGAGCTCCTTCACAAGCGCCTCGCGCTTGGCCTTCTCGACGTCGCGCTCGCGGATGATGTTCCAGATCTGCTTGGCGCGCGT
GACCATCTCGTAGTGCGGGCGCTGCATCTTGCGCTGCTTCTTGGCGACCTTCTGGTCCATGAACGACTTGTTGGCGTCTTTGTCGATGGAGGCGGACGCT
GGGCGCTTGAAGCCACCCTCCTTCTTGTAGCCGCCATCCTTCTTCAC