Description :
From Genome Similarity Track
Location :
Scaffold_14:329095- 337070
Sequence
7975 bases(100 bases per row)
TCAGAAAAATTGGAACTAAGTGAAATATATTTACTGTTACAAATGTCACTTCAAACTTCAACTCGTATTTCTTTAATGTTGTCATGATCCGAATCGCTTG
CTAGATCAAAACGCCCTCATGAGACAAGTCAATAACATTGACTGAAGCTTGAGCGGGACGGGCTTGAACTTGGACAGCTTGGGCCTGGGTCGGTGGACGC
TGACCACGCTGCGGCTGCATCCAGCAAGTTCTGCGACGCTGAGCGCTCCTAATGCGTATTGAAGCGTCCCGGGGGGACATCTTGCTTTGTTCGCTGCCGT
CCATTGCGTCGAGATCACTTTGCAATAAAATTCGTGTAGGTGCTTTGTGCTCGCTTGGTGACCTCTGCAGAGAAGTGCACTATACTATAGACTAGGAAGA
ATAACGTTATTCTGTAGACGACGTTATATACGAACGACGCTAACATTCAGCAACGATAAAAGATCAGCGTTATATCGGAGCAGCGGTAGCTTGCCTATAG
CGGGCCTACTTGTCTTGCAGCATTCGACCATGAGTACTGACAGCGAGGAGACGTATTTGTCGCCCAAGACGCCTCGTAAAACGCCAGGGAAGACAGCTCG
CTCGCACATTCGATTTCTTAGTCCAGCAGATCTTTAAGCTCGACCTGAACTGCCGCCAGCTTGCGCGTGTACTCCTCCATCTCCACGGTTGCTTCTTCGT
CACCCGAGCTGAAGTCAGCGCCTGCGCGGTCATTCATCGTCGCTAAAAAGATTGTAAAATTTGTAGTCAAAGAAAATTAGGGGGCAGTTTTAAATGCTTG
CTATGTCCGGGTATCGATTGTCTCTATTTTGGTGAAAATCCGCCGCCCAATTTGCTCCTATTGCTACATTTAGAGCACCGATAAACCAGTAAAAAACAGT
TTAACGTCGCTAGCGTTGCGCTAAACCCATGTCGTGAAGTTGTAATATGGTTATATAACGTTGCATTAACGCCATTCACCCAGTCGGTTATATTCTGGTA
CTATTACCTCGTCTCGTGCTACCTAGTCTGGCTAAACAGCGAGTGCCTAGTTATAATTATCCATATTGTGTTAAAATTCAATTAACCTTTACCTTTTCTA
TGTTTGCGTTTTCTGCCGCTGTCGGTGTACATGCATTCACGGTCGATCGTCATCGGCGGAATGAACTTCAGTCTCGGTCTGATTGTACTCGTTCTGCTAA
TTAATAGCGTTATTTCAAGGGTGACGTCGCCACGTGGAGGGAAGGGCGCTGATGAACGTCGATGATAGTTAAAGGTAGGACGACTTAGGTGATACAACGA
CTTGATTAATACTGGCTATTAGAGCCCATGCTGGAGGGCAAGTAACACAATATACCTTAAAATCAAAATTTAATTAATAACGCTGTCGATGTCCTATTCA
ACAGCCCCTCTCCAGCTGATACGTCGGGAAAGCGTATATTCTGGACTGTCAGCAGGGAGAAGCACGGTGTGTGCAGTATGCCGAAGCCAACTATCAGTTG
GAGCTATGGCATGCTCGTATGGGACAGCTCGGCGAACGGAATGGCCAAAACGCAACAGTCCACGGACGGTATACCGACAGTGAATAGTGAAATCAAGACT
TTGTGCGGTGCCTGCATGAAGGGAAGCAGGCCGTGACTTCATTCCCGGCTCGATCCACAACGAAGACATCGCGCGTTCACGAACGGGTTCACAATAATGC
GACGGGACCAATGCAGACGCGATCAAAGGGTGGTGCGAAGTACATTCTGAGCTTTGTTGACGACTACTCGAGGTATGTCGTGCAGTACTTACTGAAAAAC
AAGAGTGAAGCTGCTAGCAGACTAGAGGAGCTTAAGGCGTTCTACGTAAGCCAGTGGGTCAAACGTCTAATGTTCTGTGATCTGACAATGGGTCGGAATT
CGTAAACAAGAAAGTCGCCGACATATGCCAGAAAAATGGGATCATCCATCGCGATCCGTTCCATACAGCCCTCAACACAACTGAGTTACAGAATGGATGA
ACCGGACCATCATGGAGAAGGAATGAAGTATGCTATACTACAAAAGTGTGTCGACGAAATGGTAGCCGTGCTGTATCTACTGCGATCTATCTGATTAATC
GATCGACGAATAGCGAGCACTCGAATGCCATACCGTACGAGTTAGAATTCAAGGTGAACCCCACGCTGGCTCACCTATGCGTATTCAGGTCGCAAGGACA
CACACATATCGACGATGTGAAACGATCTAAGATACGGCTCAAGGCCTACAGGTGCAAATTCATCATTTACGTTGCGAACGTAAAGAGATATCGCGTGTAT
GACTGGGACGCACCCAAGGTCAATGTTTCGTTGTCTGTGAGGCTGGACAAACGTGAGGTGGACGAGCTATACGACACGCAGTCGCCAGATCACGACACGG
TCGTTCATGTTACGAGGAACGGTGAGACAGCCGTGGATATGGTACAGACGGAACGTCAACCCGTACAGAACGAGCCGATGGAAGAGGCCGAGCAACCCAT
TCAAGACGTTGAGATAGATGCGGTCGGCCCGGGCTGCGCCGACCCAGATCGCATCAAATCGGACCGCACTGGCCCAGATCGCTTCATATCAGACCGCACT
ACCCCAGCTACCGCCACTGTAGGAGTCAAGGTCGAACAGATTGGAGTAGGTAACGTATCACCCGCCTCTTCAAAGGTTTGACGAGGATCGCACTGTTTTG
CATCGGGGGCCGGAGCGCTCGAGGCGACCTCGTGAACCGGTGTAATTGCTGGAGAGCTGACCTGATGATCGAGGATTGGAGACCGGAAGCGATGGACCGC
AATTTCCGAAATGCGCAGCATTCGATGAGGACGGACTCATCGCGGAGACAGTACTAGCATACGCCGCTAGTATCCGGGACTCCACGGATTTGACGACTAC
GTATGAATAGGCAATGGCAAGCGAAGAAGCAGCAAAATGGTGCAAGGCCGTGAAGGCGGAATTGGACGCGCGTACAAAGAACGGAGCGTGGGCTCTGGCG
CGACGTAGGTCGGACATGCGACCTATCGGTAGGTGCTGGGTGTTTAAAAACAAAAGGGATGAGAACGGTCGTGGACTTAGTGCACGGCTGGTGGCGAAAT
GGCTCAAACAGATCGGATTCAGGAGCTGTGGTGAGGACCAATCCCTTTACGTCAAGAACGGACGAAAGTGACAAGTTTATGCATGCCTCTACGTGGATGA
CATGATTGTCACTGCGAAGGCTAGTGGCGAGATCCGCGAGGTGAAAGACGCACTCAAAAATGCATTATAAGATGAAGTAGCTGGGAGGCTGCAAAGATCA
CTCTTTAAATGGAGATCGACATCGATCGGGCCACACGGACGGTTACGATCAAGCAAACCGGATGTATTGACGACGTGGTAGAACGGTGTCAACAACAAGC
TAAGACGATGGAAAATCCGTTTGCATCAGGACTGAAACCCCTTAGATTGCAGCCACCGAATAGCTGTCAAGAACGGGTCCAGATGCGATTCAGGTCGATC
TTAGATCGGATATCTTCTGTACATAATAACCTGCACGAGACGAGACATCGCTTACGTGGTAACGCAGCTGGCTCGATTTTTCGTGAGCCCGGGACGCGAG
CATTGGAAGGCTGCGGCTCGTGTTTTGCGATATCTAACTGAAGACGACGCGAGAGCACGGGATCATCTACGAAGGTCGTGGCGTGGATATTACGATCCAG
GCGTACATCGAATCGGATTGGGGCAGCAGCATTAACGACAGACGATCGGTATCGGGTGTCATGGTGATGATGAATAGCGCACCGGCCGTACTCAAGTCCA
AGTACCAGAGGACAATTGCCCTCAGCTCGGCCGAAGCAGAGTACATGGCGCTGAGTATAAGTACTCAAGAGGTACTTTGGATGCGGTCGCTGTGATGCGA
CCTAGGTCGGACGCAAGGGGAACTACGCAGATTTGGGAAGACAATTAAGAAGCGATTGCCAGCAATGATTTTTATCACGCAAGAATGAAGCATGCCGACA
TACGCCATAACTTCACATGGGAGAACGTGGAGAAAGGAGCATTCGAGGTGGACTACATTGCGACCAAGCAGTAGTTGGTGGACATGCTCACAAAGCCGCG
CAGTACCAAGCTCCTGAAGTATCTACGGAGAAAGAGCGGTATCAAGGCAGCGGGAAATATGCCGTAACGGCGAGAGGGAGTGTTGAAGTGCACCGTCATC
ACATGGTTGATTACGCAGACCGCAGAACGGAGTGCAGTCCGGCCCGGCCCGGCCCAGTTCGGTCCGGTCCGGATAATTACGGTCCGACCCACATCGGATG
TTGTAGGTCAATACGATTTGACTGGCTCTGGTGAAGCGGGAGCGGTGCTAGCATAAACACTCACGAGTAGCTAGCAAGGGGAACAACCGAGAGAAATAGT
GTTAGGAAAGACAGGAAAGGCAGGTTTGGTTGGCATTAATCTTCTCACTTCAGCGTTTACCTCCTCAACCATAACTGCCAAACCAACCGCTTTCAGTACA
TGTGGCCAAGCCGTTTCCCCGCCATAAAAATAATTTTATTTTGGGATTTGTCCTCGCTTCGTGTGATTTATCCTAGTAATTACTAGCTGCTAGCTAACCA
CAACGCAACGCTATCAAACACCGCAAGTCATGCTCATTTATAATGGCAGCACCATCGGCAGTCGATTCAGTGATATTTCTAAATTTTAAGGGGAGCAGCA
CTTCAACCCTGCTGGAAAGATCTCGACGCTACGATCCTCCTTGCCGATACTGACGCGCTGCTAGGGTTTTATACTGAAAAGCAGATAAATGTCATCCTTC
ATGAATGAGCTTTTGACGATGCCGACATGGAAAGTCTAACCAGAGGCGCCAGCGAAAATGACGAGATTGGCGAGTGCAAGATCCGCAAAGCAACGGAGGC
CGACGGACGACGAGTCTATCGGCGGATACAAAAGCTTGAGCGCGAAGAATTGCGGCAGAAGCACGAGTTTTAAAGAAGGAACTATCACGTCCAAAGAAAA
AGAGAAGACCATGTTCGACGCGGCCCAAACGCCAACGTTTTGGTTGTGGAGGTCTGTTGCAACTCGTCTACGCCGTAAATGGATGCTGGCTGGAGGAAAA
GCGGGCCTTGACAACAAGTGACCAAGTCCAAACTGCGTACAGCAGAAAGCTGCGTGGGGCTGTCCGGAAACGAGGGGAGAATTTGCCTGCTAAAAGGGAC
ACGAACAGTCAAAAGCGGTGTATCAAGAAAATGCTGTTGGGAGCTTATATTCAGAAGCTGGACGCGAATAATACAAGTGTTGTGCTGTGTTCTTGGTAGT
AAGAACTGTTTACTAAACACAACATTGCTATTTTTAAGCGCTTACTGTGGAGGCGCTTACAGTTAGTCATCAGTGCATTCATACGTACATCAGATAAAAG
TAATTATATTCATACGAAGCGAAAAATTAACCAGTTGGCTCCTGCATAAGACATCAATCTGTTGAATAGAAGACCAATCTGCTGGTAGCTTGTATTTTTT
TATCACCCTACGGGGTACTATAGAATGCAGGGCTTTCTTGGGACACGTGCGGTATTTTGTTTACAAATTAATTGCTAAAAAGTTTCATTTTAACTAAAGT
ACTATAGATTTTTTTAAAATAACGTTTTCGGTAAGTATTTTAAGTTTTACTGATGCATAAAAGAGCTACATGTACCACAGACGAACCCTTCAGTAGTAGT
CCCTACGCTTGGAATACCTGTAATGGGCTCTCCCAGGTTACATATGTAGGTAGTTTTATAGGTTCTTTGTAGTGGTTCACACCATTACATAAGTAGGTAG
ATTTGCATTACAAAAGTAGGTGCAGCAGCACACGAGTAGCGTGTGCTGAGCTGCCGTCACCTTATTGGTTGAAAATGGGGAGCCAGACCCATAATCAACC
AATAAGGAGTTGACGTGTATTTGAGTGGTCAGGGCAAGCTGCCCTGGACCTAAATAAAAAAAAACAGAGTTGATTTTCCTTCAGACTAAGTACTTGGTTT
CAGTATCACTGGACTTGTACGCTTCCTCATCACTACGTGTAAGCAAGTAACGGACACCCCATGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCCAT
GACCAAGTTCACGATGAGCCAAGGCATGACGTCTGAAACGCCAGGGCCGACCCTGGAACATGCTGCTTTCCCTCATCTCACTCGTGTCGAGTGGAAAGCC
CTTCACCACCTCGCTGCTGAGCTCAGCGACGTCCGACCAACAACGCCAAGCAGCCCAAGAGTTCATGGAACGCGAGCTAGCCGATGCGAATCGGCGAGCA
ACAACTCCCGCACGTTCCTCGAAAAATGATGTCGTGAAGCTAGAGACGTCTACCTACTCCGGTAAAGGAGAGAATCGCCTCCCGCTGAACCGGAGGTTTC
GCGAGGTCGACATCGCGATTGCTTCGAGAATGATCGAAGCGCAAGGGTCAAAGGTCAATTTCTTATTGTCCCGGTTGTCCGGGAAGGCCAAGGAATGGGC
CCTCGGTAAACTTGTCGTTGATTACGACGCATTCCCCACTCTGGAGTCTCTTTAGAAAGATCTCAGGCTCGCGTTCGAGCCCCCTAAGACGAGTTCCGCG
TGCGTGCCGAGTTCTTCGCCCTTCGTCAAGGTAAAATGACTATGCGCGACTACGTCCAAAAGACTCGCCACCTCGCGTCATGCATCGTGACAAATCCGAT
TGACACAGCATCGCAGGTCCATGTATTCGTATTCGGCATGCGTGAAGGCATGACGCGGTACTGCCTGACCCGAGCGGAACCTTCCTCTCTCGAGGAAGCA
TTCGCCCTCGCATTACGCGAAGACTACGTAGTGGCGGCGTCTTACGCGCGCGCGATGTCTACGGCAGCTCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN