Description :
From Genome Similarity Track
Location :
contig_36:329044- 330641
Transcript NameFunction/comments
g7484.t1hypothetical protein PHYSODRAFT_316269
g7485.t1hypothetical protein PHYSODRAFT_508363

Sequence
1597 bases(100 bases per row)
TGGCACAATTACCTCAACTCCGGTTGGTATGCCGCCCACGCCCGAGATAAACTGGAGGCTGTCTGCGCTGGCAAACCTTGTATCAATGTGACTCGCGACG
ATGCGCGTGAATACTACTCCAGTACGGGACCTCCGTACATCATGACGCGGCACGACATGGAGGCCATGATTGACGATTACTGCGACTTCGTCGTGCGTGG
TCGGCAAGTGGAACAGGCTTGGATGGTGGAGATGTTCGCGTACACTCTGGCTGTAGCAAACCACGGCATCAAGCACACACTGTTGACAAACCTGGGAGCG
ACCCACCCGAAACTAGCAGTGGAAGAGCGTGAGTACTGGGACTTTGTGGACGACACACTGAACCCTTGCGAGAACACGTCCGCGGTCGTCATGCCGTCCG
ATCCGCCGGTAGGTATCCACTACTGCCAGAAGTATGGCTTCGTCGAAGGGGACCACAAGGGCCACTACTACTACAAGTACGATCTGCCCGAGACACTCGT
GAACTGTGATAGTCCTTTGCTGATGGTGCCTCCTACATCCGACTGGGATGCGCTGGAGACAACGACGGCACGCGAGCTGCTAGCGCAAAAGCGGCATGAG
GTCTGGGTCGAATGCTCAACTACTAAGATAGTCAACCAGGCATGGTCAAGTACAAACAGCGCGCCTGCCCCAACGGATACAACACACAGCAAGGCATTGA
GATGGTTAAGCCGTAGACGGTCTTCGCTACAGACACGAAGAACATTATATGATAGCAAGTCGAAGTAGCATAACCTGAGTTCCGTGAGTGAATGAACAAC
GTGTCAAAAGAGTGGATTCGATGATTCCAATGAGGTGGGGCCTTAGTGTTCGTACTCTCGAGCCGAGCGGGTTCGCGCTGGAATCTACAGAAGTCCTTGG
CGTGCCAAGTCCTCGTACGTCTTCTTGTTCAGCACGTTACCTTCTGAATCCTCGAACTCCTCCTCATTTGAAGCATTCCAGACCTCTGTATCAATCTGGT
CCTTCAATTTCTCGTACACTGTTTCAACAACAACAAAAAAGATAACAAGCGATCAGTTTGTACTCAGCGGCCCATCCGGTTGAAGCACAAGACAACGCTT
ACACTGAATGGCGTCCCTCATGAGCGTGATATCGTGGAAGTGCTTCGTGTTCGGAATCTTCAGACAGCGCATGCCAAAGGCGTGACGCCATTCTTGGAAG
TGGCGATCGAATGCACGCCGCCCCCAATAACTGTGGTTGCCACAGATCTCGCACTTGAACTCGACGCCAAGTCCGTGCAGCTTGTACAACCAGTACGGAA
TCGGCTTCCCGTCCCAACCGAGCGGTAGGTTCAATGGATTGTAGAGCTGCTCTTCTTCGTCCTCACCCTCTTCATTTTCGTTCTCCACATCCACATCGGA
GAATGCTCCTTCTTCCTCCTCCTCGATTTCAGCTTGGAGTTCCTCGTGTGTACGGGTTTGCTTCAGCTCCAAATATGAAATCGTGCCTTGAACGACTTCC
GTTAAGAGCTCGTACATCCGTCGGATCAACACCTCGTCGAATGCGATGCCCTTCTGTCTCGCCTCCAACTCTTTCTTGGTGTCTTTACCCGAAGTCG