Description :
From Genome Similarity Track
Location :
Scaffold_518:329- 5436
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_518-snap-gene-0.5ATP-binding Cassette (ABC) Superfamily

Sequence
5107 bases(100 bases per row)
GTGGCCACGCCAAGTCGCCGTGCTCGTGTGGAAGAACCTCGTGCTGCAGGAACGTCGCACTCTTAGTCGAGCAGGTCGTGCCGCTGCTCTTAGTCTCGGC
GCTCGTCGTGCTCGCGAACCTCGACTCGCTCTTTGGCCGCGACGCCGACTCGGTCTACCGGTCGGGTCGCCACGCTGCGTCTCTGAACAGCACCCTCTTC
TGCGTACAGCTCGCGTCGCTCTCGGCCTCGGATCTCGGCGCACCCTCGGGCACGATGCGGTCCTTCTACTCAAGCGGCCAGAGCGTCGTCGGGCTCTTNN
NNNNNNNNTCTTCTGCGTACAGCTCGCGCCGCTCTCGGCCTCGGATCTCGGTGCGCCCTCGGGCACGATGCGGTCTTTCTACTCGAGCGCCAGAGCGTCG
TCGGGCTCTTCTTCCTGCTCAGCTTTATCAAGCTGGTGTCGTCCACGACCGCTGCCATGGTGCTTGAGAAGGAACTCAAGATGCGCGAGATGCTCAAGAT
CACCAACAGTGCGCTGCTCGCCTCGTGGGTCGCGACGTCCACGATCCTCTCGCTGCCGGTCGTGTTCGTACTCGCGGCGCTCTTGAAATTCGGCAACGTC
TTCCCCACGACGCCGTACGCGACCGTGGTCTTCGTCTTCTGGTCGCTCACGCTCGCGATCGTCGCGTTCGCATACGCACTCACGCCCTTTTTCCACAAGG
CGCGCACAGCCGCGATCGTCTCGGTGCTGCTCTGGCTGCTGCTCTTTTTCCCGTTCTTTGACGTGCAGCCCAAGACCACCGGCGCGAAGTTAGGTGGAGC
ACTCGCGCCGCCCACGGCGTTTGCGCTCGCGATCGATCGCCTGCTGCGCGAGGCCCAGCTCGGCACGGGCTTTGCATATTCTATGACCATGGCCGCGACG
ACCTCGGCGTTCGCGGGCGTGCCGTCGGCCGAGGCCATGAGCCTCTTCCTGCTGCTGGATGCGTGTCTGCTGCTGCTGCTCGGGTGGTACTTTGAGCAGG
TCGTGCCGCAGCCCTATGGCGTCCGCAAGCCCTGGTACTTTCCCTTCCAGTTCAACTACTGGCAGCCGCCCCAGGCCAAGTTCAAGCTCACGCTCTCGAG
CAGTCCAAACATAGTGCCGTCACCGAGCTTCTACGCGCTCGGCAGTCCCGACGGCGACTGCAACAACGCCGCCGACTCACCGATCCACCACTTCTCGGGC
GGCGCCACGCCCGGCACGGCGCTGCTGCAGATCCCGATCGCTGAAGAGCGCCGCTCCTCAAGCATCGCGACGCTCGTCGAGCCCGTGAGCGCCGAGCTCG
CCGTGCAGGAACACACGGGCGCGAGTCTCCAGCTGCGCGCGCTCACCAAGACGTTCAAGTTGGTGGACGGCGAAGAGAAGACGGCCGTGGACGAGCTCTC
GCTCACGTTCTACTCGGGGCAGATCACGTCGCTGCTGGGCCACAACGGCGCCGGCAAGACCACGACCATCTCGATGCTCACGGGCCTGTACCCGCCGACG
TCGGGCGACGCGCTGCTCTTTGGCCGGTCGCTGCAGACCGAGAGCGACGCGTTCCGCCAGATCATGGGTGTGTGTCCGCAGCACGACGTGCTGTTTCCCG
AGCTCTCGGTGGACGAGCACCTCGAGTTCTTTGCCGTCATCAAGGGCATCCGCGGCCGCGAGGCCATTGCGCAGTCGGTCGATACGCTGGTCCACGACGT
CGGACTCGTGGGCGCGCGCCGCGTGCTCGCCAAGAACCTCTCGGGCGGTCAGAAGCGCAAGCTCAGCGTTGCGCTCGCGCTCACGGGCGACANNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTGCTGGGCGATCGCATCGCCATCTTGGCCGACGGCAAACTCAGATGCGTCGGTTCGTCGCTCTTT
CTCAAGACGCGGTTCGGCGCCGGCTACAATCTCACTATCATCAAGCGCAGCAACGGGGACGGCATTCCGTTCGTCGTCGAGAAAGTGCACCGGCTCGTCG
AGTCATTTCTCGGCGATGGTGAGTCGCAGCTCGCGAGCGACTCGGCGTCCGAAGTCGTCTTCACACTGTCGACGCGGTCGTCAAGTCAGTTTCCACGGCT
CTTTGACGCACTGGACCGAGACATGGCGCTGCTGGGCATTTGCAACTACGGCATTTCAGTCACGACGCTTGAAGACGTGTTCCTGAGCATCGCCAACGAC
CGAGGAGACCATGACGACGACGACGTCCCCGCCGCCCCCAAAGCCTCGCCTCAGTCCGTGATGAGGTCACTCACGTCGACGCCGCCGTTCCGAGACCAAG
TGCAGACGCAACTGCTCAAGCGCTGGTGGATCTCCAAGCGCGACAAGAAGAGCCTGCTCAATGCCATGGCCATCCCGCTGCTCTTTCTGCTCGTGCTCGT
GCTGCTGCCCGAGATCCAAGTCGCGAGCTTCCTGCCCGACTACGCCACGTCCTTTGCCACGCAGGCGCAACAGGACGCGTGTCCACCCGCCCAGATCAAG
GAGAATCTGCTCTCTCGTGCGACCATGGACCGGTGCATGGGCACCGGCTTTGGCTTCTGCTCGCTCGGGCTCATCGACTGCGACGCCGCCGTGTGCTGCG
ACGCCACGCGCCCGCAGAGCCCGTTCTACGCGTGCTCGACGTGTCCGATCCCGGCGACAAAGGTCGTGGCGACAGAGCCGTGCTTCTCGTCCAAGTGCAT
GACGCGCAGCGGTGCCAAGCTCCAGGTCGCGCTCAACGGCTTCATCGTTGCCATGCTCGTCATGCTCGCGTTTGCCTTTCTCCCAGCGGCCGTCATCGCG
TTTGTCGTGAAGGAAAAAGACCCGACGCAAGACGCCAAGTCGCTCCAGTGGATCTCGGGTATGGCGCTGCCGGCCTACTGGACTGCCAACTTCGTCCACG
ACATGGTCGTGGTCTCGTGGACCGTCGTGGCCGCGCTCGTGATAGTTCCGCTCTCGCGGCGCGCGCTGTCGGGACCGCAAGAAGTCGGCGCGCTCGTGCT
GCTCGTGGTCGCGCACGCGCTGGCCATCGTGCCCATGACCTACTTGTACTCGCGCCGCTTCACCAAGCACGCCAACGCGCAGACGTCCATGCTCGTCTTC
TCGCTCGCGAGCGGCGGGCTGCTCAGCATCTTTTCGTTCCTCTGCCGCGTCGTCGACTTCTCCATGACGTCGTCGCTCACGCTGTCGGGGCTGGACCGCG
ACTACCTGCGCTGGCTCTTCCTGCTCTTCCCCGGCTACGCGCTGAACAGCGGCATCTACGAGATTGCGACCCGCAAGATCACGCGCGGCTCGCTCTTTGG
CGGCCGAAATGCCGACCCGCGGGCCTCGCTCTTTGGGCTCTTCAAGGGGTTCGGACAGGATCCGCGCTGCGTGGCGTGCTGGAACCGCAACACACCGGGC
TGCTGCGTGCGCGGCACTCTGGCCTTTGACGTGGCACTCGCACCGGCGCTCGTGATGCTGCTCGAGGCAGTCGCGTTCAGCGCGCTCGTGTTTTACCTCG
AGAAGCGAGCGACGCAGGGACCAGCTAAGAAGACCGAGGAGGATGAGGATGAGGATGAGGACGAGGAGGACCAGGACCCCGGGAAACGAGAGACCATGCT
GCAGGTGCTGCCCGTGACGAGTGACGTGATTGTCGAGCAGGAAGAAGACGAAGCCGAGTACGACGAAGCGAGCGAAGGTGAAGAAGGTGAAGACGACGAC
GTGGTCGCCGAGCGGCGCCGCATTGACGCCATGCCGGACGGCGGCACGATCGACGATGCGATCGTGATCCGCCGCCTCCACCACGAGTACGCGGACGGCC
GCGTGGCCCTCCAGAAGCTCAGTCTCGCGATCCCGCGCGGTGAGTGCTTTGGCTACTTGGGTGTGAACGGCGCCGGCAAGTCGACGACCATCAAGGTGCT
GACGCGCCAGATCGTGCCAACGTCGGGCGACGTCCACGTCGCTGGCAAGAACTTTCTCAACCATGGCCGCTCGGACGCAGATGACGAGGACGACGACCAT
GATGCAGCGGACACGGGCCCGTCCGTGATTGGCTACTGTCCACAGTTTGACGCGCTCCATGACCTGCTCACGGTCGAAGAAGAGCTCACGTTGTATGCGC
GCATCAAGGGCATCTCGCTCGGCCGCGTGCCGCTCGAGGTCGACGACAAGATGCACGCGCTCGGCCTCACCGAGTACCGCCACAAACTCACGCGCGGGCT
CAGCGGCGGCAACAAGCGCANNNNNNNNNNGGCCATTGCGCTGCTCGGGTCGCCGCCCATCGTGATCCTCGACGAGCCATCCACGGGCATGGACCCGAGC
GCGCGCCGCAAGATGTGGAACGTCATTGCCTCGAGCTGCGCCGTGCACCGGACGAGCGTCGTGCTCACGACCCACAGCATGGAAGAGTGCGAGGCGCTGT
GCTCGCGCGTGGGCATTCTCGTGCAGGGCCGACTGCAGTGTCTCGGCAGCGTGCAGCACTTGCGCCACAAGTTTGGCCGCGGCTTCACAGTTGACATTAA
GCTCGACAGTGAGCCCACAAAGCTGCAGGTCGCGTCGCTGCGAGGCCGCGCCCACGAAATCTTGGAGGACCATCCAACCGAGATCACTGAGGAGCAGGTC
GCGAAGCTGTGCGAGGCACTGGGCGACGCCTCGCGCATGGAGCGTATCGAGAAGGCGGCGCAGGGCAACGCCGAGTGGTGGAGTCGCGGTGCTGGGGGCG
TCCGCACGATGGAGCTGGACCAGTTTGCCGCGTGGTGGCTCGCACAGGACCGGCACGATGCGCTGGCGTCCTTCTTCCCCCAGCGGTTCCCGGGCACGAC
GCTCGTGGAGCAGCACGGCGACCACGTGCGGTTCCACATCCCCAAGCACGCGAGGGAGTCGGCCGTGGGCAGACACGACCGCGCGTCCGAGTTCGAGCTG
CGGCCCAAGGCGATTTTTCAGGCGCTTGAGATCGGCAAGCAGACGCTGTGGATCCAAGAGTACAGCGTGAGCGACACGTCGCTCGAGCACATTTTCAACC
GCATGGC