Description :
From Genome Similarity Track
Location :
scaffold_1487:329- 4264
Transcript NameFunction/comments
Pl_100624hypothetical protein PHYSODRAFT_341850

Sequence
3935 bases(100 bases per row)
ACGTCATCGCTCTCAATCGGGTCACCAGTTTTCAGATCGATGTGACTATATCACATTCGCCCCCTGCGTTCTACCCAGTCGTACAGCGCCCGTTAACGCG
CATTCTTCCGCTTGCCGACTACCAGATCGCAGCTTACCTGTTGCTGCTCATGTCCGACTCCAATTCGTCGTCGCCAGGCGGCCATGCTGATCCTCCTTCT
GCTCTGAGCAGAAACTCGGTCTCCTCGACACATCCAGACCGCGCTCCGCCCCCTCTGTCCGTCGTTATCTCATCGGTAGACCCAGTATCTATCCAAAGCC
CTCTAGACACCGTCGTTGCAGCTTTATGTCGTGCCGATGAACTTGTCGAGCTCGAAGAAAACCATCGTAACCTTCAGCAAGCGTATCGCACTCAAAAGAA
TCACATTCGGGAGCTGGAGCAAGAAGTACGGGACGGGTATGCTGCTGCAGCTCCGTTCGTTCAGTTTGTCGAACACAAGTACGACCTGATGCGCCATCAG
CGGGATAAAGCTCGGCCTTCGCTTGCAGATTGTTTGAACGTCCTACAGGACCGCCGCGACAACTCAGTCGAGATCGCGACCGCCCGTGAGCACCTTCGCC
TAGCTGAGGAGATGCACGCGGATGAGATTACTCATCTGAACTCGCAAATCAACGACTTGGAGTCGAGTATGGCTTCTGCTCGCTCTGCAGCCGCGGTTTC
TCCTCGTTTGGTCCGGCGTCTCTCCGCATTAGGCCGAGAGCTAGCTGAGGCCATCGCCACACGTGATCGTCTGGCGAGTGAGCTTGCGACTGCCGAAAAT
TCCTTTCAGTCGTCTCGTGAAGAGCTGCACCGCACTGCCGCCGCTGTTCACGCATATGAAGTCTCCCAGAAAGGACTGAAGGACTCCGTCGCGCAACTTC
ATGATCAGGCCGGCGTCTTAGAGCGTCGACTGGCTAGTACACAGAGGGAACTGACCGCTGTACACGAAGAGCGCGATCGCTTCAGTGATGGCGCCATCAC
AGCGGAGGGAGAGGCTCACCGCCTCACCTCCGAGCTCCAAAGTGTCACAGCCGAACGGGACCGAGCCGCTACTTCTCTTCGAGACTCCCGTAAGTGCTTC
TCCATAACTATTTTCACCTGATTATGCATCTCTGACTTGGTTATTCTTGCATGTTGATCAGAGAATCACGTGGCTTCATTCCGCGCGGCGATAGCTCGGC
TGGAGGGTCGGGCGAATGCTCTTCTCGTGGATCAAAACCGGCTCCGGGATTTGGAGCAAGAAGTCGCTACCCTGAGATCGGTCAGGACTTCTCTGACGCA
AGACCTCGACCAATCAAGGGTCGATTACCGAAACCTGGAGGAGCAACGCGACCGTGTGGCGCGTGAACGGGACAAAATGCGTGCCGGTTGGGACACCGCA
GTTTAAGAACGCGATGCGATCCGGTCTCAAGTTGCTGGGTTGGCATCTCTGGTCGGTGTCCCGACCACCGGATCCCCTCCTCCACCTGCCGCTTCGCTTC
CCTCCGGCCGTTCTAAGCGTCACCACAGCCGCTCCACCGATCCTTCGTCTCGTCCCTGTGGGCGGGCTCGTAGGGACTCATCCCGACACCGAGATCGCTC
TCATTCCCGAAGGCTGACTCCTGGGAGTCCGAGAGGGAATCGTGGGTCGCGTCGGTCCCCTTTCGGGTCTCCGGATACATCGCTTGCTTCTCCCCGCAGC
GGTGGATCTCCGCCACCCAGTCTCGTATCTCGTCGGCGTCGTCAGTTGTCTCCTGGCGCGTGGTCGGACCCCCGCCAACCCATTCGGGTCGACTCTCCTT
CCAGCAGCTCTAGCGACTCAGATTCCAGCGATGCTACGAGCAATCAGCCTCAACTTAGCGATCACGGAGCTTTGGAGAGTGACTCAGATTCTAGTCATAA
CCGAATGACTCCCAGTGGAGGTGGCTCACACGGTGGTGGCGGAACGCCTAGCGGAGGGAGCAGTAATTCGAGTGGAGGATCTCGCCAAGGTAGCGATCAC
AGCAGCGTGAGCGACGTTCCTCGTATCCCTCACAACCGTCTCCTTACTCAAGCTACCTTCAACCGGCTTCCTACCACTGGCATGCCCCGCAACCAATGGA
TTCCAGGCTATCGCGCTCGGACGTGTGTGTCGGCTATACACATACAACCCTGGCATGTCAAAAGCGTACGCCGTATCTGTGTGCTGGAGATGGATTTGAA
CTTGCTCTTCCATCACTTCTCAAAACCCAAGTACTGGATATTCCCGCGAATTCGTCCGTCACATGCTCGTCGACAATGGCGTCCCGAACTCACCACCGAA
GCTCAAGTGAGGGCCCTGTATGCAACCACCCCTTGGCAGGGATTGGCTATCCCCGTGGCGCCGATTTCGTTCGTGGCGGCGGACTCCCTCGAAGCTATAT
CTCAACGCTTCTCCGCATTCCAGGAGCACCACCAACAGTCGTTGTGGGAGGCTACCCATTTCTATCCGGTGTCTGCGCAACTTCGGGCGAACAGTACCTA
CCTGGCTGGGCTTTGTCGTGCCCGGGAGCAGCGCCGTCCAGGCTTGGTGCGGCCTGGAAACGGTTCTTACAGTGGGTGCTTCGCGGTCTGGTCGCCGGCC
AGTGTGATCTCGATGTGTCCTTGGATCCCTTCATTCTTCACTATCCCCGTCCCGGTGAGCAGTCTAGATTGTATCCTGGACTTAACTGCAGCCCGGCACC
TGTTGATCTACTAGACGCCCTTCGTCTAGCGGATGACATGGAGCCGTGGCGCAACCAATTCCGTGCCCACCTCCAGAATCACCCTGGATCGCGGCTAGCT
CGACTCGCTGGTAAAGTTATCCCTTTGGATGAGGCCTAAGTAGACTCGGTGCCCGGACAGCGGTCGGGACGTGCGTCGCTTCCAATCTAATCGTGAAAAC
TTCTCTTTCTCTCGCTTGTTCACTCATATTACATGTATCCCCTCCATCTCATCATGCAGCCGTCCTGCATGCCCTTCACTCCACTCCTCCTCGTAGCAGC
TAGCCCGCTACGAGTAATTCGCCTCCTCTTCGTTAGACTGCATCGCCCCAAAACGGTGCCTGCTCGCGCGACTGCGTTCGTACTCTTGTAGAAGAGCGCC
GCAGTTGAGGTCTGCCTCATCTACCCACGTGGGCTCGTCGTAGCCCTTCCAGTAAACCTTGAACTCTCGATGCGCTCGTCCATAGCGCGTACGTCTTCCC
GTGCGCATGTCTACGATGCGCTCCACCTCGTACTCGCCATCTCCCATCGGGGTCTCCCAACTGTCTTCTGGCAGTAAAGCCTCGTCAAAGTCGACGCGCT
CGCCTTCTTCCACTGTCAGGGCCGCCTTCGGGCGGTCTGGGTACACTCTCACCGGTTTCAACTTCGAGAGGTGAACTATAGGGAATATGCGATAGCCCGG
TCTAGCCGTCTCCAATCGCGCTGCATGGTTGTCGATCATCTCAATACACGGAAAGGTCCGTGCCACATGTGCGCAAGCTTGCGTGCGTACCCCTCCTTCA
CTCGATCTAAGTATAGCCAAACTTGTGTCCCTTCTTCGATCTTGTGCGGTCGGACCTGCTCGTTGTGTTGATCTTCCCGGGCCTGCATAGCCTCGCGTAG
CTTCTCGTTCACCACTTCTGGCCCGGTGATACTGTCTCTGTATTCTGTATCGCCATCTTCGTGGCTCGGAGTCTCTCCGCCTCGTCGATCCGAGCGGGAT
GCTCGCCTCTAGCGTGGATCGTGGGTCCCAGCCGTGAACTAAGTAAAATGAGGTATCCCCTCGCGTCGTGTCTTGCGCTGTATTGAGTGCGAAGGTCAGA
CGTTTAGCATAGTCGTCCCAGTCTTGCTGATTAACATTCGCGACGTACATCTTCAATGCGCGGGTCAGCGTCTGCACCGTCCTCTCGGCCTTTCCATTGG
CTTGCGGGCGGTATGCCATAGTGGCACTCTGCCTC