Description :
From Genome Similarity Track
Location :
Scaffold_3013:329- 2343
Sequence
2014 bases(100 bases per row)
TTAGCCCTCTGTAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCATCGTGGATCCAACCTCCATTGCTTGGATCT
CAGCCCATCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTTGGCTCCGCCGGGAGCTCCACCTCTCCGAG
AGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCGTCC
TTCGCTAGCCATCGCCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTATCGCTGACGTTCGTGACCAGGAGGTATTGTGATCGACCTGGCCCCTGGA
TTACGGTAGGTACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCACCCACTTTAACCGGTCTGGCAGCTCCCAGGTTTCCCCGGGCTCGAT
CCAGGTTGTCTTATCCGCCCTTATGGTCCTCATCTTTGCTCCATACAACGGTCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCAGGGAAATGAAGTGTC
CCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTCGACCAGCGAGATCTCCAACCCAGATGTCAAACCAAT
ACACCAAACAACCTGCTAGCGTGATCTTGATACGCGTTCTCCCATTCGTACGGTACACGCCTTCACCAATCCCAACACAGTCTTGGATCCGACTCCCATC
CACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATTTTGCCC
CCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCGTGGTACTTCCAGTATCCACGGGACTCCCCTGTTAGCAGATCCATGGATCCAACATCCTCAGATC
CACAGGATCCAGTGACCAGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCAAACCATCGACCATGTTGTCGTTTCTCCCAGTAGCC
GCGTGCCTCTTCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAGATTCATCCACTTGGTGCAAACTAGAGATCTTGGCAACTGACACTTCA
TGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTTCACAAATTCATAAATGCAGTACCTAGAGCGCTCGG
CTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGGAGCATCCCTCGGTGCTTGGCTGGGTCAAACCATTGGCGG
ATCTGGTTGTAGAATTCTTCCATCGGGCACTTGCCGACGTCGTGAATCTCGCCACAGCCGCGACACACGTAGAAGCAATGATCTCCGGGATGACCTTTCT
TGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCAGCGTGCTTCCGGGATCCGCACTGTGAACACCTGACTTGTGCTGTCCCGTCCATGAG
ATCTCGGAATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCTGGTCGAGAGTTATCTCCGGTCTTCGCCGTTCGATCGTTGGACGCATTGAGACAG
ACTCGACGGTAATCTTCGGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTGAGTCGGGCGCCGTGACTTGGTGGACACGTAGAGCTGGGGCCG
TAGGCGTCATAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTGTTTCGCGCGATCCACCGCCCGCAGCACTTCCTCAAGCTC
GTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTGCCCAACGTCTCGATAAAATGATCCACGTGTTCCCGCAGTACCTTGGATC
CCCCATCCTTGATC