Description :
From Genome Similarity Track
Location :
Scaffold_1323:329- 1961
Transcript NameFunction/comments
Phyke_g11773Crinkler (CRN) family protein

Sequence
1632 bases(100 bases per row)
CCAAGATTCTCGCGCTATTTCTGTGAGACCAGCTCCCAAACGACGGTAGATTTGCGTCTCGAATGTTTATGAAACATCATGTGTGTCAAAATTGGCCAGT
TCGCCGCAGTAATGGCATGGGTCTATTCGTCGGATTCAGCGCTAGATTCAGGATAGTAGCGAAATTGTGCGCTGATACGAAGTGATAAACTGTTAAACTA
AATTTTAAGCTCTTCATTGTCTCTCGAACTCGTGTGGGTCGAAGCAGCTCACCATCGTCAGAAAATCCTCTGGGTTTGGAGCATCACGCAATGTAAATGT
CTCGCAGATAGTGGAGTCTGGgcccaccaccacaaacgcACGATTGACATCAACGATGTTCGGATTCTTATTCATCGCTTCGTTCAACTCGCGTAGTCGA
TGTGGCTTGAAGGTTTTCTCGTTTCGAATGGTCGCCTGGATATAAGCCACGATCATCTCTGGGCGATTGCTTCCACTCTTAAACGCTTCACACATCACCA
CTGCATCGATGAAAGGGAAGAATGGATAATCGGGATGCCAATAAGTCCTCTCAGAGAGCTTGGCCAAGCAAATGTAGCACTCATCTTCATTCTCGCCGCA
GCATTCAACATGTGGAACACATATCTCGATTCTTTCGTAGTACGAtcccttcttcatcttcaacacAACAGGAGTCTTCTTTGCGTACGCTTCATGGACG
GCATGGTGCAATAACAGCTCATATGCGGTACCTAAGAAGCCAGCACCAATAGATTCTGCATACTTGAACACTtccaactgcttctccatgCTGACATGTC
GTCCCAACAACTTCAATGCATATCCAGAATCGACCGAGACCTTCCAGTATCTTGACTTTGTGTAGTGCTCTTCGTTCTTTGGATCGGTGATGTAATGGCG
CCGAACTCGATCCACTTGATCATTGCTCCGATCACCTCCATACGTGTAAACCAGTTGGTATGCCTGCGCATTGCCAACTTTACCACAATCTTTTTCAACT
TGTTCCTCGAGAGCTTCGCGTGTCTTGCAAAACTCGCGCAGACTGCCACCAGAGTAAAAGTACTGCTCTTTGACAAGCTTGGGCCAAGTCGAATCCTTCA
AATTTTTGGTCTTGCGAAATCCAGTTGAGATCACCCATTCGGTCAAACGTGCGTACTGCTCTAGGTCGTCGCGCTGCCACGCCGGTAAAACCACAACATG
TGACGGGTCATCGTGCTTCGCGTCGTACTGACACGATGTAGCCAGAAGATGAAATGGAAGAAGTCCATTTGCTTCCGAATCGACATAAGCTTGCGAATAA
CCATCAACAAGAACGAGCGCACCCTGAAGCTTCTTTTCCTCGCGAAGGAGTTGCAAGCGATAAGCAGAGAGGTTTTTTTGTCGAGCAAACGACCCTTGTC
CATCAAAATACACCACTGCATTTGCAACGTCACCTTCTTTCACGCGCCGTATGAtgagcaccttcttcttctcgacaCATGCCATGTAGAAGCCAACAAG
CATGAGAAAGCACGACTTGCCAACACCAGGCGAGCCGACCATCACAATGCGCTTCTTTCCAACAGTAGGAAGCAGTCCCTTCACCACTTGCCAGAAcacc
acttcttccttcCGAACGAAGTAAGACGACGG