Description :
From Genome Similarity Track
Location :
Scaffold_51:32897- 37014
Transcript NameFunction/comments
Hyaar_Emoy2806473reverse transcriptase

Sequence
4117 bases(100 bases per row)
CGCGATCGGGTTCCGCGATCGGCAGTAAATGTGTCCCCTTAGCCCGCCCGAAGAGTGATCCTGATCAGTGTATCGGAGCTGGACATAGACTTGTTCTATC
ATCACTTTTCAAAGCCCAAGGGATACATCTTCCCGGTCCAACTGGGCAAAGTTCGCCCTCCTCCGGAGTCATCCTGGTCATCCCAGTTGATCACGTCGAC
CAAGATCGACCAATTTTACGATCAACAACCTTGGGACCTTTATGATCAAACCATAGAACCTATCTCCTTTGAGCTCTCCGGCTGGTTCGAAAAACTGGTC
GAGGCGTATGAAGGTTTCGTGGGCAGCCATCGCCAAGCTATGTGGGAATCGACCCATTTCTTGTGGATCTCCGCTGAGCAGAGTAAAACGGACCCTGGGT
TGGCCGCTTTTGCGCGAGCGAGAAGGCAGAGACGATCTCGTGCTGGCCCCCGTTGGAAGCGGGTACTGCAGCTGATTTTTCAAGGCATGATCGACGGCCT
CTGCGATTTGGACATTTTACTGGACCCTATGTTTCTACACTTTCCCCTTCCAAATGAGGCTAGAGTGTGGTATCCTGGCCTATCCGTGCGGCAGACCAAC
ATAACCAACTTGATCACTGCCTTGTCTATCGATCACGCTACCGAGCGTTGGAGGAACCAGTTTCGTCCTTCGATCGCATCGCACCCTGGGTCGTCTCTTC
CACGCTTGGTTGGTAAGTTCTTTGACCGCGAGTAATTTACTTGGTCTGTTTCATGACGCGATCTCTCATTATACTTTCTTCTCATTTCCATTCGATCGCT
CCCATAATTCTTATTTCTTCCATCTTTTTTTTGTCTTTTCATCTTGATCGCATCATTAAGTCTGCTATCGTCGCACTCAATTCACATAAATCCCATTTCA
TCTTCATATGCAACCTCATTGCACCCATAACGCTCCTCCCCTTACATGCACCGCCCCTGCATAGACCCATCCAATCAAGCTCTCCGATCATCGCTATTCT
CTAGCTTCTTCTTTGTGGGATTGCATCACCTCAAAACGATTCTTTCTCACCTGATCGCGATCGAACTCCTGCAACATAGCTCCACAATTTAGAATAGCTT
CATCAATCCAAGTTGGGTCGCTGTACTCCTTCCATTGTACCAGGTACTGCTTGTGTATTCGGCCATAGCTCGTCTTCCGTCCTGATCGCACATCGATGAT
CTTGTCTACTTCAAACTCGTCCGCGTCGAGATTACCCTCCCAACTATCTCCCGGCAGCAGTGTTTCATCAAAATCAAACCGACTCGCCTCATTCACATTC
AACCCACCCGTTGGGCGTTCTGGGAATACGCCAACTAGCTTCAGCTTAGACACGTGGATTATTGGGAATATCCGGTACGGCGTGCCCGCGATGTCCAACT
TTACGGCGTGATCGCCGCACTTCTCGGCCACTCGTAAAGGTCCATGCCACATAGGGCTAGCTTTCGAGCATATCCTTCCTTGACTCGGTCCAGATATAGC
CAAACTCGCGACCCGCGATCGATATCCAATAAATCTCGATCTTCATTAAGTCGATCGGGTCTACCTCTGATCGCAACCTCCAGTCGTTCATTCACTACCG
CCCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTCCAAACTTGTGTGGTAGTGGTGCAAGAAGTCTAGCTGTAACTGTTCTGGAAATA
CCAAACGAGCCAGTTCAGTACGATCTCCAGCTTCGGTGGCCAATCTCGGACAGAAGAATGGAAGTCCACTTTGGTCTACTTCATAGTCCGGTGCGATCAG
GGTGCACACCTTAGCTTCAGCTGCCGATAATTTAGCTACGTCTCCAACCAAATAAATCTTCAAACTAGATATCCCGTTTTCTTCGTCTTGTGCTTGCTTA
ATACGACCAATCCGTATCTGCTGCACAACCTCTTCCTGTAAATTTCTGGGCTGACAACGTCTTCTCTGGGCTGTTCGAGTTATAGCCGCTACTTTGACCG
CACGATCAACTCGTTCTGGTAGTAGTTATTCGTTTAACCGATTGAGAGTAATCAGGTCCTAACGCTCTTGATCGGAAACCACAACTTCCCTTTCTCTTGC
TGTAGAGCTTCACTCGCCAATCCATCTGCAATCTGATTCCAGTCCCGCTTCATGTGCAAGAACTCGTGGGATGGCCTCGATCGTAATCTCTCCATATCCC
TATGCCTCAGCAACTGCAGTCCCGGCGCTTTACAGTCGATTTCTCCTCGCATTTGACGGATCACCAAATTCGAATCTCCGCAGATAACCACCCGTCCCCT
TGCCTGATCGGCAAGCAAATCGAAACTAAGGAGCAGCCCTCGGTATTCTGCTTCATTCACGGTTAGATCGGGGGTATACTCGGAAGCAACAGCCACAATC
GTCCATTCCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCCCTTTCTTTTCACCCTGGCAGATCCATCGAAACTGGCTACCAGCAGGTTTCATTCAC
ACCTACTGTGGGTGGTGGCATGCTTATCGTCTGTCTTGGATGCTTCCTCGGGGCGATCGCAATCAATACTTCATCTACTTCTTCACGAGGTGTTATAAAT
TGTCGCAAGTATGCCGAGTATTTCATCTTCCGGTGTAATTAACGCACTTAAAAATAAAAATTTCCCTTCTTAGATCGCCTAATTTCCAACATCCAGTTCG
ATAATAAAACAGCCTATCTTCCCAATCTTCCGTTGGGGCCTGAAGATTGTAGTGACCATGCTAGTGTCGAATATCGCGTAAGCACCGTAATCTCACGGGG
ATACTAGCATAGTATAGCAGATATCTAGCATCCGGAGGAGAGCCAATACTTCTTTCTCCACCATCCCGCAGTTGACCTCGTTGGGCTTTAACGTAAGACT
GGAGAAAGTGACAGTACAATACATACCATCATATTCTTGAAGCAAAGCAGCTGATACATCCCACGTACTAGCATACACCACGATCACAGGCGATCGATCG
GGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGCTTTTAGCAACGTGAATGCAATCATTGCCTTCTCCCATCGATTCCTGCCCTCGGGATCGC
GATCATCACCCGCAATT