Description :
From Genome Similarity Track
Location :
contig_58:32893- 34932
Transcript NameFunction/comments
g10396.t1hypothetical protein

Sequence
2039 bases(100 bases per row)
ACTTGAACCACAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGCACTGCTTGGTCCTGGGTTTGCACCCGCGTGCTTCGCA
CACGGGCTTCAAACCACAGGCATACTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTACTTTCGTAA
AATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGTTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGAT
ACTCGACCAACGCCTTGAATCTCGATCTTGACGTAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAG
GTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATG
TCGCCATCGCTGATGAACACGATGCACGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATGGTGGCATGGATGACATGATCTTTGAGTTCGA
CGATTCGCAGGCGTTGTTCCGTTGCACAACCCCAGGTCAGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTG
GGATGCCACTGATGTTCAGGGAGTTTCCTGCTTGAATAAGTTCCCGTCCTCTTCATCCTCCACTGAGTCTGTGGACACATATTCTTGAGATGGCCCAGTC
ATACGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGATGCGACTTCCGAAT
TGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTT
GTCGATGATGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCTCCTCTCCAACGTTCAGCAGGTACTCAGAAAACGCAGCCATTT
CTGAAGCACTATCGGAGGTGGCAGCCGTATGTTCTTTGTCAGACGCACCTTATGGAAAAGTGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTC
TCTGTCGCCGAGCCGCCCTTCACCACCTGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTTGAAAGGCGG
TGTATTTTGTCCAATCAGCAGTGATTTCATTCGGCTACTTCCGATGTGATGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAAGTTCCACTAT
ATAGCCAATGAGAGGGCTCACATTATAATAATAGCGAATGGGGAGGCCGCCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGATTTGC
GTTACGCTCCGGGTGCGTACGGAATGACGGACAGACGGACGGACGGACAGGTTACTCTGTTACTTGTAGGAGATACAGCCACTCGGGTCCACCTTACCGT
GCATAATATCAGCGCCTGTCCGGCCGCCCATTTCACAAGCCAACAGACCGTCGATGGCTGCGTACACGTTGCCGGGTGAGAGCGGTGTAACACCACCAAA
AGCTTGAATTTACGCACCCACAGTTAAGGCGGGCTCACTCGAAAGAGCGTGAACAACCACCCTCATAGGGAATGCAGTGGCCAAGGGGGTGGGGGTCAGC
ACTCAAATCGTGGAAGCAAATCACCATTATTATAGTAGGTTCTGCATCACAAACACGAGCATTCACTTCAATCGTCCAGACAAATCGCTGAGGATGGTGA
AACTGGGGATTCGAAGAACGCGTGAGCGCCATCGCGTATCTTGTGAATACTACTGATTCTCCTATAGTATTGATAATTCCTTACCAATTGATTATCGTGC
GGGATTGAATTGACTTGAGAAAACGTAAGTCCCGCATGC