Description :
From Genome Similarity Track
Location :
contig_58:32887- 34928
Transcript NameFunction/comments
g10855.t1hypothetical protein

Sequence
2041 bases(100 bases per row)
TGACAGGGTTATGTTTTATTCAGTATATTTACTTTTGACTTGAACCACAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGC
ACTGCTTGGTCCTGGGTTTGCACCCGCGTGCTTCGCACACGGGCTTCAAACCACAGGCATACTCGCTGCGCTCGAGGGGGAATGGTGACTCTCAACAATT
ACCGCTATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCGCTGCCTACGCCCTCTCAAACAGCTGTCGGTACACTATGCTC
GCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATATTCGACCAACACCTTGAATCTCGACCTCGACATAACCCTTGACATGGCCACATACAGCTGAC
CGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAA
CTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTGATGAACACGATGCACGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCC
ATGATGGTGGCATGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCAGGATTTAAGTTCCGCATCATGATGA
TCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTTCCTGCTTGAATAAGTTCCCGTCCTCTTCATCCTCCACT
GAGTCTGTGGACACATATTCTTGAGATGGCCCAGTCATACGATCCGCTACGGCTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGC
GACTCGCAAAGTACTCGTCCGATGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCG
GATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGATGGAATCTTAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCTCCTCTC
CAACGTTCAGCAGGTACTCAGAAAACGCAGCCATTTCTGAAGCACTATCGGAGGTGGCAGCCGTATGTTCTTTGTCAGACGCACCTTATGGAAAAGTGGC
CACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTTCACCACCTGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCA
CGTATGGGAATGAAAAGAAACGTTGTTGAAAGGCGGTGTATTTTGTCCAATCAGCAGTGATTTCATTCGGCTACTTCCGATGTGATGTAGTCCACTCTAC
GCATTATAATAGCCAATCGCGCAGAGGCTCCACTATATAGCCAACGAGAGGCCTCATATTATAATTATAGCGAATAGGGAGGCCACCTTCGCTGCGCTCG
GCAGCTATTTATAGCCAACGGAAAGTCCGGACTTGCGTTACGGTCCGGGTGCGTACGGAATGACGGACAGACGGACGGACGGACAGGTTACTCTGTTACT
TGTAGGGGATACAGCCACTCGGGTCCACCTTACCGTGCATAATATCAGCGCCTGTCCGGCCGCCCATTTCACAAGCCAACAGACCGTCGATGGCTGCGTA
CACGTTGCCGGGTGAGAGCGGTGTAACACCACCAAAAGCTTGAATTTACGCACCCACAGTTAAGGCGGGCTCACTCGAAAGAGCGTGAACAACAACCCTC
ATAGGGAATGCAGTGACCAAGGGGGTGGGGGTCAGCACCCAAATCGTGGAAGCAAATCACCATTATTATAGTAGGTTCTGCATCACAAACACGAGCATTC
ACTTCAATCGTCCAGACAAATCGCTGAGGATGGTGAAACTGGGGATTCGAAGAACGCGTGAGCGCCATCGCGTATCTTGTGAATACTACTGATTCTCCTA
TAGTATTGATAATTCCTTACCAATTGATTATCGTGCGGGAT