Description :
From Genome Similarity Track
Location :
Scaffold_191:32886- 34600
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_191-snap-gene-0.16Abnormal spindle-like microcephaly-associated protein homolog

Sequence
1714 bases(100 bases per row)
TGCAGACCGTCGAGTTCCACGACATTATGCAATACGCCTGGGTCGTCGAGTTCAACAAGCACGAGCAAAAACAGGAGTTCTGGAACGTGGTGCTCAACAA
GCGCACGTTTGACGTACCGAGAGCCATGGAGCTCATTGAGCGCATGGAGATCGAGCAGCGCCAGGAGGTCGAAGCGAGAGTAACGCTCGCAAAAGCCAAG
TTGCTGGACCTGCTGTACCCGTTCCAGCCTAAGAACAAGCTCAGGCTTGCCGCGAGACGCCATGCCCAGGTGTACTTGCCAGTCAAAATGAAGAAGACTG
GCAAAGCGTACAAGCGCGATGACGACGATGAGGATCAAGCCAACAAGATAGGCAAAGACGGGGGGTTTGACAATGACGACCACGTGAGTGCCATGGCGTG
CGCGCGCTTTTGGCACAAACAGATTCTGGTAAACGAGCAGTTTGGCGGCAAGAAGGCGACTAAATTCCTCCATGCGTGTCTGGAGAACGCGCCGCACTCG
ACGTTGGACTGCTGGGTGGTGCTGAAAGTTTGGCAGTGGATGGATTTGTACGAGGCCGACGGGTTTGAGAGCCACGCCAAGACGTTCTTCAATTTGGCAG
GCGACCTGCAGCTCTACATTTCGGGCGAAGTGAAGAAAGCGTTGCTGGGTGAAAGTGATGATGGGACTAGTGCTAGCACAAAGTCCCAAGAGAACAATTA
CAAGGAGGCAAAGAGCAAAATGGTGCAGTTACTGAAATTAAAAGACGAGACGCTGCAGTTGCTGGTGTTCAACGCCATCCAGGAGCGAGCGGCGGCCGAG
GACAATGCCGCAAAAGAAGACACATAGTGGACATTCCCCACAGTCAATCCAAACATGATGGGCTAGTGGATCTCATGGTAGCCGTCCAGTTGCAACGCAG
GCGGCAGCTACTTCTTCATTCGCTTGATGGCTTCGAGCAACGAGCTGCGCTCACGAACACCACCTTCAGTGAGCTCTTTGTCATCCTCTTGATCATCAAG
AAGCCCTTCTTCGAGCGAGTCCATCGTATCTTCTCGTGGCGATGAGGAAGACTCCGTTGACTTGGCAGTACAAGCCAGCAGACTGACGAACTCGGCCTCG
TCCTCGGCGTCAGAGGCCGAGGGCTTGAGCTTGGGGAAGAAGCGGCGGTACGGCTGGTACTGCACTTGGATAATTGCTGCGATTGCAAACAGTGCCACCG
CGACAAATGCGATGAAGAAGTGGGCTGTTGGTAGAGAATTTGACAGAAAGAGAGTTAGCTTCAACTCATGGTGTCTGTACAACATGTCAAGGTCTTTCTC
ATATGATCTCAAAGCAAATTACTATACTCACATTGGTAGAAAGGCGGGACTGGGGATTGTGATAGAGAGAGGCACACAAAACGACAGCATTAAGGTGGCG
TTATTACAACAACGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTCACCTGTGACGAAGAGGTGCTGCGGCGTGTACGCGAGC
ATCGCAGCGTGGTGGTGATTCAATGAACTCGGCAGAGACGCCATGAGCACGAACCGGTACTCGCCACTGGACCGGAAGTGGTCGGCAAATACGTCGTCCA
GTTTCACGTGGTGGTGAATCTTCGTGCTGGTTGTCATTGAGTCGTTCGTAGACGGGATGTGCTTGGGCAGCTGGTACTGGACACTCGCGCGCTGGCGGAC
GCAATACGGAAGCG