Description :
From Genome Similarity Track
Location :
Scaffold_70:32883- 36488
Transcript NameFunction/comments
Phypl_g2351hypothetical protein

Sequence
3605 bases(100 bases per row)
GGTTGATCTTCTGGCGACTGAATTACCGCACTAGACGAAGGCATCGTTACTGCACGAGAAATGCTCCCAAAGTCGTGTCCAATAGCCGGAGGGTAAGCAA
AAGGCTGGTGTCCCAGATTTATGCGGATGATTTCCCCTCGCTCAAGACTGATACCAGGCATCATACCTGATCGCTTATCGTCCACGCAGCACTTGAATTC
AGAGTATGCTACGCCCAAATTGACTCCATTCCGGAAAAAAGTCATCTCTTGCGTGGTTAAGTCCAGTAAGCAGCCGATGATATCACCAGCTCTCCACTTC
TCTCCGTATGACGAAGATCCACTGTTCCAACGTCGCTGCCGGTTACCATCGTAGGACCATGAGTGAGCGTGGTCTCCGACTCCTTCACCCTGGTCTGAGC
TTCCCTGAAAGTAGCCATCAATCCACCCTACTTGGATCAAACCACTAGTAACAACCTCTACTTCGTAAAACCATTTGTCTCGAAAAAGCGACACGCCTAC
CGTGGATATAGAACCAAAGTTGCTTAGACCCTCGATCTCTCCTGAACGGTCGATATCGACACGACCGCAAACGGAAACGACACAAGATTGGTCCTGCATA
ACGGAGTCACCGTCATCGTTTTCGCGTTTTCTCTCCACAATTAACGAGGTGGTATAaaatccagcagcgacgtccacaCATCGACGAGAATTTTTCTCCG
GGCGAACTTTAAGAGGGACAGGTAGCAGTGCATCAGCGCTGCCGCGATTTCCCAGTTGTCCTTTATTGTTCCGCCCGAAGACGAAAACTTGTCCTTGTTC
AGAAAGCAGTACCGTGTGGTAGCAACCGCAGGTTGCCCGCATCATCCGTGTGTTGGCAGACAAGGTCACAACATTTGGCACATTCTGGTGAATCTTGCTT
CCGATTCCCAACTGCCCATAATCATTACGACCAAACGAAAATGTCCGACCGCCAGTAGTAACTATCACCGAGTGGTAGTATCCGCATGCAACAAAGCATA
CCATCTCGTTTGGAAGAGCAACAAGGGTGGGTGCCTTGACCTGGCGATTGTGAGTTAAACCCAACTGCCCGTAGTCGTTCTTTCCGCAGGAATACAGCTc
ccctgctgctgtgcaaATGAGTGTATGATACAATCCGCACGCTACCATGGATATTTCGGTGCCCTCGAAGCTCTTAACGAGCTGCGGTATCGACTGATGC
TGCGTGTgatcgaggccaagctgaCCACAATCATTCATACCAAATGTATAGAGTTCTCCCGAGTCCGTGATCACAGCACTGTGGTGGTAACTGACGGAGG
CATAACCAAGCTTTTTGTCCTTCAAGGACTCAATGAGCTTTGGGACGTGGATCTTGGTTGCCAGGTTTTCATGCCCCAATTGTCCTCGATCATTGTAGCC
CCATGAGTATGCGAGTCCGGAGTCTGTCAACGCGATCATATGCTCGCATCCGTTGCTCGCAGCAATAAATTTCACTCGCTGAGAGCGCAGAGCTTGGACA
GGGCGGAGCATCATCACTCGTTCATCAAAATGCCCCTGGCCACACTGACCGCTCTTGTTCAGCCCGCAGGTTAACACGACACCGTCATTCGTGAGAACTG
CCAGGGTCTCGTTACCACTAACCACCTGACGAATGTCATCCCACCCGCAAAGTGCGACACTAGTGAGCTGGTGCCGCTCGATATCGTCTCCTGTACCTAG
TTCTCCGTACGAGTTCTGCCCGCAACTGTAGAGTTCTCCCGAAGCCTCGCACTTTCCGTACATGGGTTGTTCTTTCAGCGCCGCGAGTTTACCCAGTGAC
GTTTCCAAATTCACCGAACTAGTAGGTGGTTGCTTCATCAGCCAAAGCACAACAGAGAGCATCGTTGCGAGCGACCCGCGGGCCAGTCCCACCTCAGCCA
GTGTCTCAATCGTGCGAGCTCCGATGTGCACTTCACCTTCAGACCCTCCATCGGAGACCGGGTAAGCAAGATCTCCTAGACATTCACTCAAAAGATTAaa
ggccgaggacgcggacTGCGCGAGGTACATACTATCCGCGTAGGCAGTCGGCTTCAGAGGCTCCAGGTTGTCTTTCACCATCTGCAGTGCTTGTTCGTAT
TGCTCTGGGTTGTTTTGCCGTgtcgccttcagcagcatgacCACTAGGTCCCATCCCATGGTCATGCAGTTCTGCGTTGGTagtggcagtggcggcggcg
acacTTTGCGCAGTGACATGGCGTGTACCCTTGCAGCCAGCAGTCGCTGTTCGTGCCGGtacttctccttcttggtcatTTGGTACACATTCTGCAAGTT
CTTCACGTAGCTGGCCACGCGGGCGTCGAACACACCTGGCATCATCTCGCCAGAGTCTCGTTTCCCGTCGGATCGTGCAGGGTCGAGTCCGTCTTGCGTC
GGCAGTCCCGCCAGCTGAGAAATGTGATGGAATAACTCATCCACCGAGTCCACGGAGCTCatgagctccttcatctgctgctccggACTGCGCGTCGACA
GGAGTCCGGACACTTCGCTCTCTGTCGGTAGCaaacaagcagcagcaatgtcaGAAGGTTATGGTGCTTAGTACTGGGGTTATTGAATGCATCTTTACCT
TTTGGGAGGCAGCGCAATGCGGCACCGAACTCAAGGATCTTGTCCGTAGCGTCCTTTGCGTCTTCGGCAGCCGTTGAGGCCACTGCCACGCCCGAGTCGC
CGGCCTTGACCACGTCGGAGAGCGGCACGTAGGGCGCCTGCAGCGGGCGCAGCTGCGTGCGCTCGCCCGGCGGCTGCGTCACCGCGGCCGGAAGCGAGAC
CTGCTGCCCCATGGCCCGGCGTCAAGGTgtcgcgctgctgttttTCTTTGTCTGCTGTACCTCGTGTCGGTCTCTCAGCTCAACTCGATCAGTGCGCACT
GCGACTCTTCCCGACATCATATATCTTTGTGTGGTGTACGTAAGTAAAGTGTGATTGGCTGAACGCGTTTTATTCAAAGCATTTGGATTGGGCAAATATT
GTGAACTCAATTTGGTGACAGTAGCTGTGTGCGATGTCAAAACAACACCACGCTGAGGTGAGACTCCAATGtcagctcaagcgcgcaACCCTCTTGGCTT
GGTGCTTCTCGAATTCTCACATCGTATGATGATAGTAGCCAGTGTGGCGATGCCTGCTACCTCTCTGAAAGTTGCTGGCCAAGGTCGACGCAACTGCTAT
TATAGAGGCGAGACGGCCCCATGTCGTCTCGTCAAGCAGTCCCAGCCCGAGGAGGATCCTAGGGCTAGCGAGAATCCGCCCTAGGAAAGTGGCGGAAAAC
CAGGTCGCCTATCGGTGGTCGCCTTCAATTGTGAGTTACTACGTTGGTTGACAAGAAACCATAAGTTATCGAGGCGATAAGGTATTGATATCATCGGTAC
TACATGTAATTCACAAGCATGGCGGTAGTGATCTTCTGTAGATCGATTTCACATTGGTGCTTGCTTGTCGACATTCACGCCGTCTAGGATAGCGAGGAAC
GGTCACATACAGTGAGGACATACTGCAAGGCATAGCATCTTACATGAACAAATGCATCTGATGTTGCTTTGACGCGGCCTACGTCGTGCAGGCTGCATTT
CCCGA