Description :
From Genome Similarity Track
Location :
Scaffold_70:328801- 330075
Transcript NameFunction/comments
Physo_139145hypothetical protein

Sequence
1274 bases(100 bases per row)
GGCATTGTGAAGAACGAGTCGACACCACCGACGCCGGCGATGGTGGAGGACGACCTTAATTCGGGTGCGTGGTTTGAAGTGGTGGGGTTGTATGGTGGTG
GTGAGGCTGATTGGTGGCGTTGTGGTGAATGCAGATGCACCGTGCACGTCGATTGGGCTGTGGAAGTATTTGTATGCGTACTCGTTCTTCAAGACGATTA
CACCGGAAGATATGGAGCAGGCATTGCTGCTAGAAGGTAAGTTTGGTATCGATATCATTCGATACAAGCGTTTTATCGGCCGTTGTTTTGAACGTAGTTG
TTGACGGATGCATTTTGCTTTGTAGATCCTAATGCATACTCGGAAGAAATAGATTCAAGCGAAGAAGGTCAAGACAAGGTAATATCTGGCCTCGACTTCA
AGCGACTTCAGGATAATTTCAGTTTGAGCAAGTCTAGCCCACAGGATCTGGACGACTTTTTCAAGGAGGTAAGCAATGCTCGCTACGTTTTGCTTTTTTA
CTCCCCTACTGATGTCGTGGCGTCCTGCTATCGTTGGTGCTTTGATACAGAGACTGGTAGCGTCGCTGTGCCCAGTGGAAACTTCTTCCTCATCGAAAGA
GGGCGACGCAGCAAATGCGTTGATAGATTCGGCACAGCCGGACGATGAGGACAAACATCCCAGAGACTCGACAGAATCACATGACGCTACACTGTCGAGC
GCTTCACTGGCCTCTGTCAACCTGGCATCGTGGAAGTCTAAAGGCCTCACGCGCGTCCTGCGTGATATCGGGTTGTTAGAAGGCAGCGAGGGGGAGATCG
CTCAGCTCGGCGTGGCCAGTCCCAGGGACGATGAAGTTTCGCAGGAGATCCGTACGCTGCAGCTTCAACTCCGCACTTGCGTGGAGGATACAAATGAGGC
CAAGAGGAAACTGCGCAAGATTATGGACGAGTACGGATTGTGGAGGCGCCCGAGCATAAGGAAGGCTGCTCTACTAATGATTATTGCTGTGGTATGCTAT
CTACAGAACGAAACCATGGCTCTCTCAGAAGAATGAGAATGACGATGCCACCATTAAGAAGTACTTTACGATGTGGCAAACGAAGAAGGTGCGATATATT
CCTGTTGAGTAGTGTCAGTTAAATCCCTAACACATTACGGTCGTGTCTGTTGATAGGAGCTTGCGAGGAAAAAGAAACTTCGAGACAAAAAGCTTCAACG
ACGACAAGGTACGTTAGATACGGCTTCGAGAGGTTTTGTAGATGTGAGAACTAATTTCAGTGGTGTGTACAATA