Description :
From Genome Similarity Track
Location :
Scaffold_1457:3288- 7223
Transcript NameFunction/comments
Phypl_g13457hypothetical protein

Sequence
3935 bases(100 bases per row)
CTTGGTCGTGGCGCAGCATTGAACTTGCTCCAAAACATCTGAACACGCATTCTTCATAAGCTTCAGCGACATCCCGAGCCGTTGTTGAGCTCATCGGTTT
ACATATCACAAAGCCTGAAAACGAGTCCTGAAACAGGAGCAGAAAAGTATTTCCGCGCTCAGACTTTGGCATATGAGTGACGAAATCCATCGACACAAGC
TCAAACGGACGTCGGGGTGCAATGTTACCAAGTGACGGGCCAGGGTTCAGAGGTCGTCCCTTGGCCGACGCGCAATCGGAACATTCTTTGACGAACACTT
CCACATCGGCGTACATACGCGGCCAGTAAAACTCTGAACGCAGCTTTTCATAGGTTCGCGTGATGCCCTGGTGCCCACCTTGGTAATCCTCGTGAGCGTA
ATGCACTATGTCTGGACGCAGATCAGTCGGCACAACCAACTTCAGCTCGGACTCTTTGTCTCGCGGGCGATCTCGAGTGGCCACACTCAGGCGTTAGAGG
ACGTTCCGGAAGTCCAAGACGTACTGGTCGGCATACCtggcgatcttcttgacCTGAGCGCGGGTAAATTGGTCCAGCTCTCCTTTCAGATAGTACTTTA
TCTTCACCAAGAGTGAATCACCATCTTGGTGCGCTTTAATCCTTCGCCACCGTTCTGCCTGGTATTCCAGCGGTCCCATCGCCTCGGCTTGCGGTAACTC
CTGTTGCGACCGAGCGCGGGTTACTGCAGCCATGCCTTTAGGTATCTTGGAGACCAATTCTAAATGCAGTCgctctccagcatctccaaccTGCCAAGAT
TCACCCAACGACAGGGTCTTGGACGTCAGATAATCTGCGGTTTGACATGAACCAACCGCAGACTCTTGAACTTGGGTTTGAGAGCTTCGACCTCAGCGAG
TCTGCGTTGAAGGATCGGCTGATGGCAATTGATCAGACCCTGGGCTTGCTGAATCACAATCCTCGAGTCACCAACTGCAACCAAATCCTCAACTCCTCGC
TCAATAGTCATAGCTAGACCTTTTAAGAGCCCATGATACTCAGCGTCATTCACAGTCACGTCATTGAGGATAAATCCTCGAGCATCAATCACATGCCAGC
CAGGCAATTGCCACAGAACACATCCACAATTTTCTTGACGAGTCGAAATCTTGGCCGCACCATCAAAACTCAGCACAATACCTTTGTAACCCGATTCAAG
CATCTCAATGCTGAACGCAGGTATTTGCTTGACTCGTCCCTTGGCCGGAATCAGTTCTTCAGCGACTGCGTCCAAATGCTTGCGAGGCGTGATAGCAGCA
CTTAGAACTGCGGCCAAACTATCTTCGTCTCGTTGAACTCGACGAAGTTCCAGTGACCACCGGGAATGCTCCAGACCTCATTTGAGATGTCGACCATCAA
CTGAATTCGACTTCAACAACCATTTCAAGACATACTATCTCGTGTAGATCATCAGTGGAAATTCCGAACCATAGATCAGTGGTCGAAACAGTTTCAAGAC
TCGCTGGATTGCCAAAACCTCCTTCTCAGCAATGTGATATCTCACCTCCGACTCGTTCAGGACACGCCCAGTGAAACGCACCGGCTGAATGACTCCTTCG
TGTACTTGTACCAACATGGCGCATGCCGCCCAAAGGTTCGCATGCGGTATAATGATAAACTGCTTCGTGCGATCAGGGTGTCGTAGTAGCGGAGTTGAAA
CAATATCACGCTTCAGGATCTCAAATGCTTCCTTAGTCCAAATGAGGTCTCGCCCTGAACGCACTTGTTCATCGTTCAGCTCGTAAAGAACTGCAGCCAC
CACAGGGAGATCTTCGATGAATTTGTTGTAATAGTTCAGGCTCCCAAGGAATGACTGAACTCCTTTCAGCGTAGATAGAAACGGCAAGTCTTGAACGGAC
TTCGCAATCTTAGGCGTAGCTCGAATTCCTTCAGCATTAATCTCATGCGACAGGTACGGGATGATCAACTTGCCAAATTCACTTTTCGGGAGACTCACAG
AGATATTCCAATACCGGAACCGAAACAGGAGCGCGTTCAAGTCTTCACATAGTCGATCCCAGGTAGGAGCACCATGTGCGATATCATCAATATGCGAACT
GCGTCCAAGCACGGGCCCATCTGCGGGGGAGCATGGATATTTCGCTTCAAAGCTGTCATCTGCTTCGTCAGTATGGGAAGCTTGGTCGTCTTGTGTTCAG
CACCGTGGCCGCATGTGTGTTGAAAACCCTAAACGCAGGTACGCCCAGAGTCCGGCACATCCAAGTCCAAGAATTTCAAGACATCTTGGTCAACCTGGGC
CTCCTCTTGGGGCGGCAGCCGAACGAACCCCACAGGCAGTTGTTGATCACTGCTTGGTATACGAGAGGTGTGTTCCTGAGTCCGAACGGCATTCGGATCC
ACTGGAAGTGTCCAAACGGGCAAATAAATGCCGAGATCAGCTTTGCGCGCTTAGTCATGAGCACTCGCCCAGAAGCCACTAGCCATATATAGGCTCATGA
ATCACATAATAGACTCGAAACCAATCAGCAAGTGATCGATCAAGGGCAGTGGATACCGAGAGAGCTTAATGAACTCGTTCACCACTCTGTAGTCAATACA
CATACGGATATCCACGCCATTCTTCTTGAGAACGATCACAATCGGCGAAGGCCACGCATATTCTGAGCGCTCGATCAGGCCTGTTTCCAGGAGTTTCTTG
ATCAGCTCATATACTTTAACCAGCAAATGCAGGGGAATCTGCCTTGCGCGCTGAGCCACTGGACGCGCATCTCCCGCGTCCAAGCCGCAAACCAGACCAC
GAGCAGGGGCTGGAGCCGCGTTTCCATCGCCTAAGAGGATTCCGCGATGATACTTCAAAATCTTCCTCAGCTTGGAGTCCATCTCTGGAGTCGCGACACC
TTGAACTCCAACATCAGCCTCCTCAATTCTGTCGTCAGGACTGAGATCTTGAATTTCAGCAAGCATTGTGAGCTGGTCGCGCAGCTGAGCCACCAACTCA
CTTCCTTCACGGATGTATACCGGTGGTTCTAagtccagctcttccaccgAGATCCGCATGCACCTCACGTACCCCGCTTCCAGTTTCCGGATAGGTGTAC
TAGCGAACCCTTGGACAGGCAGGTTTTTCCTCGGAGTCTGCGTTCAAGGATTGACCTTGACCGCATATTTCTGGCAGCCTGAGCTCAGAGATCACATCAA
CGGTAGACAGCACCGTGGCTATAGCAGCACTTGTAGCGCCTTCTGAATCTGCAGCGTCAATACTAAGACTTCTGGCAGCGATCTCACTCTCCTGGTCAAG
ATTAGTCTGTACAGCAACGTCTCTCAGCCTTGGGATGGTTCTGCTCTTCTGCTCAGGCTCCCGCTCTTCCGCAAATATCACTCGAAGGGTCGTCGGCTTT
TTGTTCACCTCAACCATCCGAACTTGCGCGGTACCGGGAGTTGATCGTAGCAAAATCTCCGACAGCCAGGGATAACTTGGAGTTTGAACGCAGGGTGGTT
CTTGATCGTACATCAACTGAGACAGCTTGTCTGCTCTCATCTGAGCTTGAGCGGACAGTGTGTTCTCATAGATGAGACGGTGGTTTATGTTTTGATGCTT
TGGGTATCCAACATTGGCGAAGGTGTTGATGTCTTACTTGGGATGAACTTCATGTTCAGCGCTGGTGTTCGACTTTCGATACGGGAAGGCTTGGTACAGC
TCCCCGACGAGGAGACTATTATCATGTACGGAGGGCCGTCAAGAGGACATCAAGGATTGGACTTGCCGGTGCGGCCAACAGAAACTTTGTACCTCCAGCC
AGGACGGAGCGCTGTTCTGCGTATTACGTATGGTCAATCCAACCCTCAGCGAGAAGTTGTCTGGGCTGGGCGTGGAGATCGTTGGGTAACCAAATTGTTG
CCACTCCTGGTACTGCCTCCTGCCTGGACGCACAT