Description :
From Genome Similarity Track
Location :
Scaffold_21:32871- 49872
Transcript NameFunction/comments
Phyke_g1353hypothetical protein PHYSODRAFT_554422
Phyke_g1354conserved hypothetical protein
Phyke_g1355hypothetical protein
Phyke_g1356hypothetical protein PHYSODRAFT_470654
Phyke_g1357hypothetical protein PHYSODRAFT_309075
Phyke_g1358conserved hypothetical protein
Phyke_g1359hypothetical protein PHYSODRAFT_293759

Sequence
17001 bases(100 bases per row)
CTGGATCCGTCGTTTACTTATTCGTACACACTTTCAGGTCACGAGTATGTGGCAAATGAAGATTTCGAGAAGGCGGTGAACTGCTACCGACACGCAATTC
GTACAGACCCTCGACATTACAATGCCTGGTACGGTCTGGGCACAATATATTACCGGCAAGAGAAGTTCGAGTTCGCCGAGTATCACTTCAAGCGCGCACT
GGAAATTAACCCGCGAagctcgctgctgcactgcTTCTTGGGTATGGTTCTGCATGCCACGCACAAGTTTGACGAAGCTCTGGATACGCTGGCCATCGCC
GCTGAATTGCAGCCGCTGAATCCCCAAGCCCGATTCCAGCGCGCCAACGTGCTGATTACAcagcagcgcttcgaggAGGCACTCGCGGAGCTGCGCATTG
TGAAGAACTTTGCGCCGCGCGAATCATCGGTGCACTTCATGATGGGCAAagtggccaagaagctcggTCGCACCGAGGAGGCAATGAAGTACTTCACGTC
GGCATTATATTTCCATCCCAAGGacaacaacctcatcaaGGTGGCAATTGACAAAATCAACGAACCGGACcttgacgacgacgaccgcATGTAACAAGCA
CCTCACTAATACGACAGAACCGAAGACACCGAAAGAACAGACCCGCATATAGATACTTGGTCTCAACAACCATCATAATGCAGAACACTATTTTTCAAAG
TCTGACGCATAAACAAGCATGGAATTGACTTGTTATTTGTATGGTGTGTAGTTTAGCATTCACCCATTACGTCCATTTCGAGGTCCGCGATGGAGCCGAC
AGAGAAAGCTAAAgctcggctgctgctgcatcaactCACACAGTTTAAGGGTGCGACTGACGCACTAACCCAACTCTTTGACGGGTTTTCAGCTCTAGAT
TCTAAACGTTGCGgtgtgctgttgcaactgctgcattggcaaAGTACCCCAGCGTCGAGTAGACTCGtggatgtgctggaagaCTTGGAGTCCAACGGTG
ACGATGGCCAAGAGGCGGTGCGCAGTGATATGACGCTGATGGTAATGGGCAAGCCAGCGCTACTATTCGCCACCTCCATctacgacgaggagctggcgaT
GATGATCTGGTCAGGGTTTCTCCAGTTCCAGGAGCGACACCCGCAATTCGACTTGACTCGACAGGTTCTGGACAATTCAACCGACTCGTTGGGTTATTCA
GCACTTCACTACGCTATTGAAGCACAGGTGGAAGAGTTTATGAGTGCTGTGTGCAAGAAACTCACTCAGGAGGAAGTGGCACATCTTGTTGGGCGAGTCG
TGACTCAAGATGTGACTCTGCCGGTGAGCACCAGTCAGAATATGGGGAAGAATATTGGCAGCGGAGGATGCTcgctgcttcatcttgcAGCGAAGAAAGG
GGAATTAGAGATGGTGCGAATTCTGGTTGCAGCACCCATGGTCATGGATCCGAAGACGCTACGTGACTGGGACGGAAATTCACCAGCTCGAGTGGCAGCA
ATCCACGGTCATCAAGACGTTGCCACATTTCTTGAGGTAAGTGACTTGAAGACATGCTAGCTCTTGGTGCATCGTTGTTCTAACACTTGATGATGCAATG
atatcttcttcctcctgaTCAGGGTATCACTGGTGATGAGCCATTAAATTCTTCGGATGTTGAGAAGTTGCGATCGAAGCGGGAGACGATGGCGAGAGAA
CGCTATTTGGCGCATTTGGAGCCGCAAGAGCCTATGTTAGAACCATCAGTGTTCTCCAATATCTGGACTATTGAGGAGACCACGCTTGTTCGTACTGCGG
TGAACCGATTGGCTGCCGAGCAAGGCTGGTGTAAGGAGAGGCATGCATCATACCAAACGACAGACATGCCCTGTCATCATGTTGCTGGGCTAGACGCCTG
GGTGCGTGCAACCTTGGCTGACAGGCTGTTCCCTAAAATCGCAAAGCGCTACCAACTACCGAAGACGCAACGACTACTTTTCCGAGACCTGTTTTTCGTT
AAGTATGAGGCACGTGAAGGCGAGCGTTCGGAGCTCGCGCTTCACCGTGATGGGTCCGTGCTGTCGTTTAATATGCTGCTGAATTCGGCCGACGATTTTA
CTGGCGGAGGCACTTACTTTGACGCTACGAAGCGCACCGTTCACATCACGCAGGGCGATGTAGCAGTACATAGCGGCAAGGTTCTCCACGCTGGTGCACC
TGTGTTGACGGGCCAACGCCAAATTCTCGTGGGATTCCTAGATGTCGCTGACTGTGTGTTCTAAGACTCGCCCAATCAGAGACGATGATATTGAATTCCT
TCGATAGGTGTATCTCCCTCCAGCACGTAGAGACGTTGGCACCAGTACTTGTCATCGTAAACGTCATCGTCGATGGACGACTGGATGGACAGCGTGGCTT
TTGCCTATCACCGCACAAGTTGAGGAACGTAGAAGAATCAAGTTAATAGAGAGCTTAGACATGATTTCAATCACAAAGCGTACCCGCTCAATTTCAAAGA
AGAGCAATCGATCTTCCCAGACCTTGTCGTAGGTGTTCCCCATCATCTACGTTCAAATACATACAACATATGAGCTTCACTCTACACGTTGTGAGAGAAG
CTGGGAATAAACTCAAAAGGCATACAGCGACTAGAAGATTCAGCAGCATAATGGTGCCGATGACCACAAACgcaatgaagaggatgatggCGAGCAGACC
ACCTTCATAAATACTGTCCCAATCCCACGAACCTAGGCTGATATTGAGCGTTGTAGTGACGGCTGTGAAGTAGCTTTTGCATCCTTCCAACTGCGAGCAA
GCGCATACACACACGAGAAATATTAGTGTATGAGATGCCATGTTGGAATCGTGAAATATCCGCGTTCACCTGAAGTATGAAAAAGGCGAAGGCAAAACCA
CCCAGGAATACGCAGAACACCATGACAAAGACCAGAATATCGGAAAACATCTACGAAGCAGTAAAAGTCAGTAAACTAGGCGCACATGAGCCACCGTACA
ACCTCGCGTACCTTAGCAATCATGCGAACAAATGGCCCGAGTGCTCTTGTGCCTCGTGCAAATTGAATCCACTTGATGAAAATCTGTGGTCCCACAATGC
TCATCAATGTTATGCGGAAATTGTACTTTCGTTGTATGGCAAAGTTATACAACGATTCTTGAAACACGATGAGCTCGAAATCGTCGTTGTCGAAACCTGG
ACACCGAAAGGAGAAATATCAAGTCATTCCGAACACACGTTGTAAAAAGAGTATAACCGCTTCATACCCGGATATATGAGCTCCAAGACCTCTCCAACCA
GTAAAAGCCATACGCAGGCAATCAGTAGCAAATCGAACCAATTCCAGCCGTCTCGAAAGTACACACGAAGACTTCCACATTCTCGATATGCTTGAAACTA
CAGTACAGCTCTTTAGAAGTTAGCACTCACTGGGAACTTAAAGTTACCCATGCAAGTAGTACCTCTTGAAATGTGTAATGCACATTGATGATGGAGTAAA
CAATCCGAGCCACGTCACGAACATATTCCGCGCAACCAACAGACCCagtgaagatgctgtcgcGATAGCCTCCAGTTGGCATGCCAAGCAATGTGTCGCC
GATGTGTAAGTATCTGAGAACCGCAGCGTTTCGTTTGTGTTAGTTACTGAATAGATACACTGACCTCCACTTCTTAGGCACGTACGTGGCAACGAAGACG
GCGACAAAATACACAAAATACACGTGGAACTGTGAACGAAACGTTTGACGAGTAAACGAGTTCCATCTGCAATAGAGAACATCGCATGTTAAGTGCTCAT
AGCTTCGTCGTAAGCAATACATTTATGGGACGTACTTGTGATCCAGAAGTTGACGGAACCATGGATGGAAAATTAGTTCCTTGCATTCAGTCTGCCATTA
AAACAGTGCCAATTTATCTTGTCGGACATGCACAGAATCACGAATTGAGATTGGTTAGATTGGTTAGTTTCGCACCTTAACGATCAGCCACATGGTTGGG
CTGAGCCGGCCACGAAATTCTGCGTGGTCGTAGACATACTCGAGCAAAATTCCTTTGGGTTCACAGACAATTTTCTCTTTGTGCccagcttcatcgtcgg
cCAAAGCAAATACATGCTGAACACTCAGCACGCTTCGTACGCGCCGGAGGAATTTCCACACTGACTTCACGAATGCCCAAAATTGATCAAATGCTCGTAA
CAGGGGGCCTCGCCTTCGCCGACGGCGTGGGGGTCGACCAACCTTTGCTTTGCCTTTCATCTGCACGAGGAGCGCCTCTCGCTTTTCTTCAACTGTCCTC
AGGTGGTTGCTCACAGTCCAACGCTGATTATGCTCGCGAATGTGTTTTAACATGCTGCATCTGAACAGAGGGTTGCGAAATGAATCCATTGCTATGACAG
CCGCGGCGGGTACGTTCTGGATCAGTAGGTGGAACAAATTGCTGTTTTGATGAATTTCACGCGCTTTGTTTATCTCTGATGATGCCAGGTGCTCTGATGC
AACGAGGATGCTCAGCACTTTCGGGGGTAGAGGCAAATACCCCGGTGTAGGACGAAAGAACACGATGTCGCGGCGATTTCGAGTGCACAAGAATGGAGAT
ACCAGTAGGCTCTCAACAGTTGAACACGTACTGTCATTTCCGGCACCGACAGCATCATGTCGAATGTTGGTCCTTCCTGGAATATCCGGGGCAACGGATG
CAGTAGCTCCGACTGCTGCCTGGTATTGTGGAAGGTGAGATTTAGCGTTGGGTTCACGCTTGTACTGAACCATAGCTCCTGAGCGGTAGTTAAGCGATGG
CATCAACTTGGCTATTGCCTTTGCATCGGGAGAGTCCACAAACGCCCCTCGCAACACTGTTCCGTTGAGTAGCGTCAGTGATACATACCGTGATATTCGT
ACATCCGCGTGGTGGGTCACGAGGTGGGTGCAGACTCCGTGGCGTTGACTTGCTATGGCAAAATGAAGCCTGCACAACACACAATGATGCAATAACAGTA
ATAAAGTCAGTCAGCATAGCCAAGTAAAAATTAAAATATTGTCCAGGAATACAGGCGTACGGTGTTTCGCCTGCTGTGTTTTGTGCGTTGATGTTGGCAC
CGTTTTCAAGCAGGAGCTTGGAGAGTGTGAGGTGTCCACCCTCGGCTGCGTAATGCAGTGGTGTGTTCCCAGCAGCATCCTTCGAGATTACCAGCGGATG
GCCACAAATTTGAAGCAGGTCCTGCAGCGTGACGGCGTCATCGTTGAGTTTGTCGAGCGAATCTGAAAATCGAGTAAATGGTACACCGATATCTGCTACG
ATGGCGCGTATCTCAGCATTGGACTCGCTTACTAGTCTCTTGGTTCTTCGCATGTCAAAAATCAGCTCTAACAAGTGGCTTAGATGCACAAAACTATACT
GTTGGTAGGGAGAGCTCATAGGGTGCGCGTTCCAATGCGCAATTAGCTCTCCAACCAGATCCGTGTATCCTCGTTGGGCAGCGACATGCAAAGCAGTGTA
TCTGAAGAAAAATAGCAACAATAAGTTAGCGCATTCTAGTCACCAAGTGATTTATGTGCACTTACTGAGCCAAACCATGGGGCTGCTGCAAATCAAGGCC
ATCGTTCGCTTCGTTCCGTAGTATCCGAAGAATCTTAGGAAGATTAGGCTCTGCCAGGCGTAGAACGCCGCTCTCCGTTCTGACCGGTCCTGGGACCAGC
GGCTTGCACCGACAGCACTCGTCAAACAGTAGTTTGTTCTGCAAGGCGAGATGTCGTTCGTCTCGCTTCGTTAGCAGCATGTTCATTCTGTAATATTTTC
GCATGGCTTGGTTGATTTTATCTGCTGCCCAGCCCTCAGGTCGTTCGTCTCGATGCAGTCTGAACTGTCCAGccaggaacttcttgagGTAATTCCCACC
TTGAGCCTTGTGGTTGTGGCCGTCATTGGGCTCTGTTTTTCTCGATCGTGAGCCCTTCTGATGCGGTCGAGAGTGTTGCGGTCTATCTTGCTCCTGTTTC
AGTTGAAGGCGTGGTGTGCGCTTGCGTACGTCCTCCATGATCACGACCTTGTGCTGTTTCTTCCTGCTGGCTCTGTGTTCCTGTTATTTTCGGAAAATAA
AGCAGTTAGCCCAGGGTTTGAAGTGATAAGAGAACGGTATGAAGTAGAGGCTCACCTTAATATGCGATCGGTACGCTTCGATCATCTCCTCGCGCGTTGG
GGTGTCTGGAGGATGTGTGGGTGACGCATGGCGCCGCGCAGAATCGGCAACCATTGCGGCCAAGGTCAAGTTTGACGTCTGTTCACATGTTGAAGCGACT
TTAGATTCGGATATGTAAATTTCGGATCAATAGTGAATGTAAGTCAAAGCGAATGACTGTTTTTCACTATGTCTCACTTCCAGCAACACAATTTTGAAGC
CATTTTGGAGCAGCGGAATGGCTGACGATGCGTCTGCTGTCTTCACCTCAGCAATGGACGGCGAGTTCTTCTCTTTCCCGTATGAGCCCTACGATATCCA
ATTGCAGCTCATGCGCCAGCTATGGGACACACTCGAACGGCGCCACTGCGGCATCTTCGAGAGTCCCACCGGCACCGTACGATAGATAGATACCTCAGTA
GAGAAGTTGCATTGTATTTGAGTATTAAATTCGTGTATTTGCTATTGCCTTCGTACAGGGCAAGTCGATCAGTCTCATTTGTGGTACCTTGACGTGGCTC
ACGAAACACACGGACGAGTACGGACTGCCACAAGCCTCTGGGGCTGAAGAGAAGGTTGATACAACAACAATAGAAGAGAAAAATACAGAGCCCAGTTGGC
TCAATGACTTTGCAAAGGCCAAAGCAAATCGAGAGGTGAAACATCTGCAACAAGTGGCGAAAGTAGCTCTGTCTGGAATCGAGAAGCTCCGACTGGAACC
TGAGGCCAGttccaagaagcgcaaaatgGGCTACGCCTACAATCTTCATGAGAAAAAACGCCCAAATTTGCAGTATCAAGGCGGCACTAAGGCGATTAAA
AAGCAGGATGgagaggacgaagaagagcattTGGTGGATGCGTATGACAGCGATCGTGTGGGCCAATCGCGCACTGatagtgacgacgaggataGAAATG
TATTGGGGTCAGGTTGTCGGGGAGAAGAGAAGCCGAATTTTGGTGTGGTGAAGATCATTTACTGCAGTCGGACTCACTCACAGATCTCTCAGTTTGTTCG
GGAAATTAGGAAGACCATATTTGCTGACCAAATTCGAGTCGTATCACTGGGTTCTCGAAGGAATTTGTGTACGAATCCAAACGTTACCAAGTTAAGCTCG
GATTTGCGAATGACAGACAAGTGTCTGGATATGTTGCAGGGCTGCAAAAGCAAGGACAGCAAGAAATCAGCCAAGTGTCCGTTTTACGAGAAATCGCTTC
TCAGACATTATAAAGACTACGCACTTGTACGCCAGTTTTCTTGCAATAAGCTTACCTATATTTTAgccactgctgttgtctAATGTATGCTGTGGTGTGC
GTGATATCATAGGCTCATGTACAAGATATCGAGGACCTGCATCAGCTAGGTGAAGACATGTCTATTTGTTCGTACTACGGGACTCGTGAAAGCATTCCAC
TTGCGCAGATTGTGACAGTACCGTATTCCATGATACTGAGCAAGGATACACGCGAATCGCTGGGCATCACATTGGAAGACAGCATCGTCATTTTTGATGA
GGCACACAATATCATCGATGCTATCAATAATACTTACAAGGTTGAGATAACCAGCAAACAGTTGGTTGTCGCGCGAAGGAGCTTGTGGTCGTATTTCAAG
AAATATGAAAAACGGTTTAAGGGCAAGAACGCGTTCTACATCAAGCAATTGCTGTCAATCTTGGAATTATTGACGAAGTTTCTGCGTCAAGTAAGCAAGA
TGGCTAGACAAAATAGCCTCGGGTCAACGAACGGTGACAACGATGATGATGTTTCCGGTGCGCAAATGATGACGATCAACGATTTTTTGTTCAGTGCGCG
GATAGACCATTTCAACATGTTCAAGATTCTGCAATATCTAAACGAGAGTAGTttggcgaagaagttgatggGCTTTGTCGAGTCCGAGAATATTGGGGCT
CCTTCTGGTCCTCAgccagttgcagcagatgaCCCAGACGAAGGTTTCGAGAGTCGCCACATATCGCCTTTACGGATTGTCGAAGCTTTGCTGAAGGCCT
TAACCAGTGCGGGTGCAGATGGCCGTATCCTCGCTCAACCTCACAATGTACGCCAAACCACGTTGCTCAAAAATGCACTTTACCCGTTCGTTAACATGGT
TTCACTATTTCTGCTGCCAGGCCAACAAGAAAATCGAAGGTGTGATCAAGTTCATCTTGTTGAATCCAGTCACACATTTTCAAGAGGTGGTGGAAAAATC
ACGGAGCGTTATCCTTGCTGGGGGTACAATGCAGCCGGTGGGTAAACTCTCCTTGAAGGCCTTCAGCCCTAAAATCTTCTTATTGGTGTCTTGGTACTCA
TCTTTTTCGCATTGTTGGATTTGCCAGGTATCGCAAGTGATCGACCAACTCTTCTCCTCTGTACCGAAAGAGGATGTTGATCTCTTCTCTTGTGGTCACG
TTATTCCTCCCGAAAATCTACTTGGCTTTAGCCTGGCGTTGGGACCTTCTCAGAAGCACCTCGAGTTTACGTATTCACGCCGCGACGATATGGAAGCCCT
GGACGAGCTTGGTCGTATACTTCTGAACCTGTCCCGGATTGTCCCCGGTGGGGTTGTTGTGTTCTTCCCTTCGTATCGCTTTGAAGAGAATGCGATTCGT
CGATGGCAAGCTACGAAGCAGTACGACCAGATCCAAGCGAAAAAAACTGTGTTTAGCGAGCCAAAGAAATCCGGCGAGCTTGCAGATGTGTTGGCGCAGT
ATTCCGCCGCGTGCTCTCGAGGCAATCGCGATGGGAGTGGCGCCATACTGTTTAGTGTCGTAGGTGGCAAGATGTCCGAAGGAATCAATTTCAGTGACGA
GTTGGCGCGATGCGTCGTAATGGTGGGTATGCCCTACCCAAACGCTAGAGACGTAGAGCTTGTGGAGAAAATGGCATTCCTAGATAAAAGGAATCCCGGA
TCCGGACGCCAGTTCTATGAGAGTCTCTGTATGAAGGCCGTTAACCAGTCGATCGGTACGTTTGAAAACACCCCTACAAGCACAGTTGCCATAGTTAGTC
ACTGCTCATGCAAACCTTTGCTAACGAAACAGGAAGAGCAATTCGACATCAAAAGGACTACGCCTCCATTTTGCTGGTTGACCAACGGTACTCGAATCCG
CAAGTTCGTAAGCGTCTACCCGAATGGATCCAGAAGCGAGTTCAGCCTCCATCGCAGTCCTTTGGGCAGGCATACTCGCAACTCGTGCAGTTCTATCGAA
CGAAGGGTGGCAAAAACAATGCCCGGTAGTAGACATCCTAACAGAGCATTTTGTGGTGCTCATTTGTACAGCTGAAAAGCATTTAATTCTCTAGCTGCTT
TTTGTATTCGGCGTGAAGCACTTGCTTTGCAATGCCCAGTACCCGACCGGCCAGTGCCTCATCGTCGTAAGACCACTCCATGTGGACTTCCCATTCGGCT
GACACTGCTACCCCTACCGTGCGAAGCTTCAGCCAACGATCGATCTTCTCAATTGTGAGATGGCGGATCCATTTGCCAAGCGCAGCCTCTAATGCGGTCT
GGAGTTGTTCGACATCAGCCTGGGGTTGTTGCTCcgtctcttcttcttcgtcggctgACTCCACGGCTGCAGACAGTAGGAAGGACAATGCGGACGCCGG
TGCGCGagagtttttcttcttcgcgcgTGGAGACGGCTCGAAGGGCTTCTTCCAGGAGTATGAGAAGAACAACGagtgtttcttcttcttcaatcGCCGC
GCGCCATTGCCACTTGACACTAACATCAGCTTGCGCTTGGGCTCGGCTATCAACATACCCTGAACATCTGACGGATTATTAAACATGGCCTTGTGAATAC
GTAGCGGGATATCTCGTGCGGGCTTGATTGGTGTTCGCCCGGCAGGACTGATCCCTTTCACTGCTAAGCTAGAGTCAATAGCCGGGTCTATCTTCAGCTG
GTTTACGATGTGTGTCTTGACAAATTCCAGGTCGTCTGGGACAGCATAATCCAGAAGAACTTGACGCGGCGCTACGCATGATGCGAGCTGTACAATAGTC
TTGGTGTCAACTTCGTCCCCGCAAGGTTGATAGTGTACTCCACAGGCAACATTAACACCCAGACGTTTGCTGATGCGCTTCcgttcagcatctgcatATA
GCAAGTAGTTAACAGTACCAGGTGTGCAATACTCCGATAGCACGATGAGGTTCTTCGGATCGCTTGCCACTGCCTTTATGGCCCGTAAGGAGTCACCCTG
AGAGATGTTAGCTGGTCCTGTAAACAACACGAACGGTCctggctgctgcagttttttCCAGTCAAACTCCTGCAGGTCACCAGCATTTGCAGGCTTCTCG
CACAACAATTTTCGGATAGCCGGCGTGCACATGCGAGACAATACCGGCAGGAAACGACTTGGGTAGTCCATAGCCGTATCTGACAGGTAGATTGGACACC
GTGTTGTGTTATCCTTCATCTGTTGCCAATGATCCAGCAAAATCGTGACCAGCTCGTGGAAGAATCCCAAGCGGTAAACGGGGATCACGACTTTGCCATT
CGAGCCGATGCACTCCAGAATGACTTTCACGAGATCACGCTCCATAGCGCTCTGAGTTTCAGATACCGTCACAGCAAAAGAGCTACGCGAAATCAGCGCA
GTTGGCTCCAGTCGCGGGATCTGAGCTGGTAGCAGTACGCGTCCTCCCGTCAGGTTAAAGTCGTTCGCAAACAGCACTGACGTCGCCCCAATCTCAATAA
AAAAAGCACATCCGCCTGCCACATGGCCCGAGTGGTAAGCTGTAACCTTCATGTTCTCGTTCACAGTGACACACGCTTTCAAAGCAACAGCCTTGACCTT
CCTGAATGCCATAGATACGTCCTGCAGGTCGTAAGGAGCCGGCAATCCACTGCCTCCGTCCTTCACCTTCCCATGACACCCCGTCCTATCAGCACAACGC
ACAGTGTGATAAGATCTCCACCCTCCTCTTATCCCCCTTCTTTATAGCCTCAAACTCACCAGTATTCAGCCAGGAGATGTGGCGCAATGGCTCGTGTCCC
GTGGGTCATGAGGACGACAGGAGGCTGCTTCTGGTTCGAttcttgcgctgcagcaccgctTGGAGTCGTCCATGATACGCCGCACTTTTCGTTCATATAA
GGCAGCATGTAACAAGCCCCTGGGCGGTAATCAGGCACCAGTACAGCGTCCAGCGTGCCGCTTCGCATTAGGTCCCGAAGTTCGCGACGGTATTgggcag
ctgcagcttcggtTTCTTCGGTGCTGGAGTCAGATGTGAATAGTGATACATCCTTGAACTCTCCGCAGCTTAGCAGCACCGTGACGCCGACGGCCTCGTC
TCGCAGGCAGAAGGCTGCGCCATTCCCCAGCCGCTCCACTGTGAAGCTCATGTTTGGTATGGCAATGGGGAGATCAGATAATTGGCTGAGTAAATCTGAT
GCTTGATCTGATTCCATCAGATGGATTTTTATTGTTCTTCAAAAATGTCGTGCGAATAATTAAACTTCAATGACGAACATGCTAAATTTTGTATGGTGAA
AAAAAGCTAAAAATAGTTTAAATGGGTGATAAGCCACGTTTTGCACCAAATATTCTGCATCGTCAAGCGTTAATACGTGCCCGATGGCTTCACCGTCGTG
GCGTCCTGCTAGCCGCCGGCGAGAGCATCAGTGGGAATCTTTGTCGCCACCGACACTACTAGAAGAGAAGCCCAAGATATCGCGATTCTCGCGGCGTAGT
ACGCgtgcacaagctcaagctcgtCAAGAGTCACAACGCATTGAACTGGAAGTCGAAGAACACAACGACGAACGCGATCGAGAGCAGCGCCGCAGTCTAC
TCGCCACCATGTTTCGACACAAAACGGCGTCGCGCTCTTCACGGACGTCCCGATCGTCCTCAGATGCGGACGCTTCACAGCAGACGCTCGTCCAGCGAGA
TAAAGCCTTCCGTCTGGTCCGTCACGGCTCCGACCCGCTCTTAAACGACGGGTTTTACGCCACACAGGTCCAAGTAGGGAACTTTGTCAAGATGGGATGG
CTCACCAAGCAAGGTCACatgtggaagagctggaagacgcGCTTTTTCGTGTTGTTTTCGGACGGAACGTTCGTGTATTACAAGAATAAAGGACGGAAGA
AAATCAAAGGATGTATGCAGCTCAACGATGGAGTCGTTTCCATCCAACATGTGGACGTCCGAGTGGCAGAGAAACCTTATGTGTTCCAGATCGAGAAAGG
GTTTTATCGGCTACtttgctattgctgcagtCAGTTTGAAGCCGAGTTGTGGGTCACAGCATTGAGGTCTGTGCGACGAGTTGCACCGCCGTGTTTTGAG
ATGGACTTGACAGCTACAGAGGAGAAGGCAGGATCGAATGCTGTCACACGACTGTTGAACAAGATTTTTATTACGGACAAGTGGCTAGCGAAGGCATTGG
AAGAGTTCAAGGTGAACGAGCACGACCATTCGTACGCGTCTATCCACAACTTCATAGTGGAGATAGACGACGCCGTCATTGATCGACACCATTTGGAGTT
TTATCAGGATCCGGAGATTGAGTTGCTGCCTGGTAATGAACTCATTCGTCTGATTCGACGTCATGTGGAAGACCGCGTGTTCATTCCTTTGTATGCTGAA
GCGTATTCAAGTTTGGCGACAACCAAGCTGAAAGAGAGACAGTCCCGCTTCGCGCAGAACctcaaggtgctgaagcgGAAGACCCAGGCAGATTTTGGCA
TCCCCGAGGATTTATCCTCAGTTTGTGGCTGGGAGTTAGCTATCAATgtggccaagatgctggatTGTGTATCTCTCCCAACCCACAAGTTTGAAGTGGT
TCTTTCAATTGGGAAAGTTATCATGGAATCGGTTGCGCAGTATAATGGTGACTTGTTCGAAGTGTCGGATGAGACACTGACTGCAGTCTTTCGATATGTG
GTGACAATGTCGTCGCTGAGTGATTTACCAACCCTGCGTGCACTCCTAAAATATGGTTATCAGCACCATCCTGCTTGTCAGAACAAAGCAAATGTCGTAT
CTGCCTTCCTGGATGCTATCAAATGGGTGGAGTGTTTTGAGACAGAGCATGAAAGCTACCAGTTTGACTCTAAGACCctttcagcttctcgcgTTTCGGT
GTCTATCTCGACCAATGACATCGGTATCCAGTTTACAACGGATGGTAATGGGCGAGGAGCTATCGTATATAGTATCCGAAAGCTGTCTCAGGCAGCTCTG
AGCGCTGCGATTGTTCCTGGACTGTCATTGATTGCCATAAATCACGAGCCGGTCATATCGATGCCTTTTGACAAGATCATACATCGTGTGAGGACTGCTA
CTCTTCCGAAACAGCTCACATTCATGACGGAATTTTACTACTACCAATTGCTATCCCTGGATTCGGATATGTTCCAGTATCTACTCTGCCTTGCAGCTCG
TCGTGGTGACCTTGACTCCGCTGCATGGCTACGAGGCTACAACGTGGAACCTAATACTCTTTGTTCATGGGAGAAGTCGCGAGGAAAGCAGATTTTCGGG
TTTGTTCCAGTGTCCGGGAAGAGCTGTCCACTGCACGCTGCTGTGCATAACGGCCAACTTGGAATGGTCAACTATCTTCTATCGAAGGGGGCCGACCCCA
ATATGTGCAATTTCAAAGGGAGGCGTCCGTTGCATGTGGTGAAGCAATCGATCGATATGGCGCAGATTATTGAGAGTCTGATAGAAGGCGGTGCCGACAT
TGACGCGACGGAGAAGCATGGGCTCACACCGTTAATGTTCATGTGTTCTCGAGGGTCGCTCGAAGGTTGTGCTACGTTGCTGGCGCTTGGGGCAGATGTT
CACTGTGTGTCGTGGTCTAATGGATTCTCAGCCCTGGAGTTTGCGGTGAAATGTGGACGTACAGAGCTGGTGGAGTTATGTCTCTCGAAAGAAGCGAATC
CTAACGCGCCAACGCTAGACGGAGATACAAGTCTTCACCTAGCTGCCGCGCTACCCCATGCTGATATCATCCTGCGGCTGCTACAGAGTGGTGCAAATCC
TAACGTTCAGAACCGATATGGGCAGACTCCCGTGAGTGTGTTGCTTGCGTCGGCTGCAGACGTAGATAGCGATGCCCGGGTTTTATGTCTCGAGATCCTA
ACTTGTGCTGGCTGCCGTCTTGACAAGCGAGATCTCTTTGGTCGCCAGGCATCTCATCTGGCACAAATCTGGAGAGACTCTCATGTGGTCGGTCTGCTGC
GAAAGATGGGCTCTTTAAATCGACCAGGCAATGACGTGGACGTCGATATCTTTGGCTGTTCTCCCGTCGACTACAGCCACCGGATAGAGCCGAACAAGAC
TGCAAACTATCTGGGAATGCAGATGCCCCACAACTTATGGAAAATTATTGGTGAAAACAATCACGTGCCCCAAACTTTGCGCTCTTATTCCATCGAAGAG
TTGGTTGGCAAATTAGTTTCAGGGACCGAAGTGGACTTGGTGGATATCATCGCCTTCGTATTATTCATGGATACATTCTCCAGCTTAAACGAAGTGGTAG
ATCGACTGAGCGAACACATTCGACACGGGGTGAAATGTACGTGCCTGCTTTATTATCAGTCAAGTGCAGCGCTATCGATGATGTTGTGTGTAACTGGAAT
CTTAATTGATTTTGTATGTGCCCGTTTAGGTCATGGGCTTATTCGCCTCTTCGTCATGATTCTACTGTACAAGAAATCTGAAGCCCAGGGGGCTGGTGAT
CTACAAGAACGCTTCAACAGCCTTATTAGTCACAACATTGACATCCCGAAGGACAAGTTGAATCTTTTGGTAGAGGAATACACCGCTCTGTATGTGGAGT
ATTTTTCCTTGCGTGGAGCTGGGAACTACGCAGTAAACTACGAAGTCATTCCAGGGGCAATGGCAAAACTCTACTGTCAGGACTCATGCACCAAGACCGC
ATCCACGGAACCGTTTCCGATTCATTTGCACCGGTAAGCTACATGTTGGCTTTAAACTGCTTTCTGGGGTATCTAATGTTTGACCGGCTGGTTTCTGTTT
TAATAGCTACATCGATGCTGAACGGTGGGCTGAACAGTGCACACTTATAACGCATGCGATCTTCTGCAAAATCCCAGGTATTGAGAAGCTGCATATTTTG
CCACGAGATGTTATTGAGGTTGCTAATTAATTGTTTTTGGAATGTAGTCCAAGATTTCATTTCGACGGGTTCGAAGCAACACTCCACTGAGTTCACGTGC
ATCAAGAGCTGGTTTCAACACGTACGCCAGTTTACTGCAAGCCATGAAGCAGTGGGAATATTGGTATTAACAAATTGTTATTTTGCAGATGTCTGCCTAC
GTCATTAACGCAGTTCTTGTACAAAATAATCCGGAAGAGCGAGCCGAAGTGATCTCATTTTACCTGAAGGTACCCCCAGCAACTTCTTTTATATTGGAAT
GACCAGTGCTAATGGCTGATCCTTTTTTGCCAGGCTGCCGATTGCTGTGCATCATTGCATAATCACGATACAATGGCAGCGATTTTGTACGCACTGCAAT
CAACCGCCGTGCAGCGCCTTCGAAAATCAATCGATTATGTACGTTGCGACTATATGGTGGTCATTGATAACTGGATTTCTATCTCACGTTTTGTGTGCTC
GTGCTATTATAGTTAAGTGTGGCCTCGAAGAAATTGATGAATGAAATGCAGCTACTTTCGGACAAGGGGTGCCGCGAAATGAACCGTTTGATGCGCAAAA
CATCCAATCCAAGCATGCCTTATATCGGATTATACCTGCAGGTGAGAGCAAGATTCAATGGTGAACAAGTCAGTGATGTAGCGCATAACTGACTGTATCG
TTGTTGCCCCTAGGGTTTTGTCGGATTGAATGAGCTGCCTGTATTCGATAAGGAGGGCCTGGTGAATGCAAGGCGGTTGCGTAAGATGGGCGAGCTGTCA
ATGGAAATCTTGCACCGTCAATCTGTTGCCTATGCCCTCCAAAACGACGAAAAAATTGACGTAAGTAGCCTGAGATCACATATTTTGTCGGTTGATCCGC
GTCACTTTAACGTCACGAACGGTGAATGTTTGTCTACAGAAACTGTTGCATGTTTCGCTGCCGTATCCTTCTGAAGAGAGTCGGTATGCACGTTCGCTGG
AGCTCGAGCCTCGTGAAGCTGACGCGATTCCGTTGAGTGATCGCGGCTCGTGTGCCGTACTCGACGATGATCTCGACATTGAAAGTGAAGTTCGTGAATC
AATCGGTGGAGAGGGAACTTTTGGTTTCCGCCAGTGGATCCgaaagcagcaagttgtgCACCGGAACCGGTCGCGCTCGTCGCTAATGGCTCAGTATGAG
TGGGTATAGCTGTAGTTGTCTTCGGTCGTCTCTCTGCCGAGTCAAAAGATTTTATCTATTGTTGCTCGCAACAGCACTAATATATTAGCACTTTTAGTTA
TTGGCGATGTACTTCTCGAAATCTTCCATCGACATCATATTATCCAGGTTTGGCAATGGCTCGACGTGGCCCTGACATTACAGAATGAGCAGTGCTTATC
ACAACCAACAAATGCCTGTAAAACGAAAAGTAAGcgcaccttcttgttgatgttgGCCTCCAGGTCACCAAAACTCTTCGCTTGCACGCGTTGGGTGTTC
GGGGATGTAGCAAGAGACGGTGGGTCATCATCCGTTGTCAGgtcttccatctgctgaaTGATGTAATCCCCTTGTGCTCCAAGCATGTAGTCATCACTGt
agagcagcatcgtcagTGCCAACAAGAGGGCCATCATTGCATCACAACGTACAGGAGACGACTCAACTGAATCTCGGCGCTCGAGGGAGGAATGTTATCC
T