Description :
From Genome Similarity Track
Location :
contig_36:328651- 330249
Transcript NameFunction/comments
g8798.t1XP_009529968.1 hypothetical protein PHYSODRAFT_316269 [Phytophthora sojae

Sequence
1598 bases(100 bases per row)
CTGGCCACTTGTGATTGCCATGGCGCCGCAACGACTTCCACCGATGTCTCGAGCCTCGCACACCAAGCGCTGGCTGGTGGTGGCGCTGCTGCTCACGTCA
CTCGCGTCCGTGGCTGTGCTCAACTACCGCGGCATGATTGCGAGCACGTACATCAACCGGTCCAAGGAGGAACGCAGTGTCCAGACGCAGCTGCAGAGCT
CCAAGGTCGTGGACGAGTTGGTGACGCTGCTGCTGGCCAAGCAGACGCAACATCACGACGTCGACAGCAGCGCCAACTCCACCACCACAACTGCAACGAT
AGCTGCGCCTCCGTTGCAACGACAGCCAGATCCACGCAGCATTTACCAGGGAGACGAGGATCGAAGCGAGCTCCACATCGTCTTCAGCATGAGCTGCGAC
CAAGGTCGACGCGTACCGCTGCAGACCATCTTGCAGTTCTCGGCCGTCGCTGTCGGCCAGCGTGGGCCGATCACGCAGATCCTCTCAGGCTGCACGGATG
TCCAGCGTGAGAAAATCATGAAGGAACCCACGCTCTACTACGACTTCCGGAGACACTTCACACCGTCGTACTCGCCGCACCCAACACCCAACGTCACGGA
TGAGTACACGCCGTACAACAAACCATTCGCTCTGCGCCACTTCCTGCGGAATGCGCAGCCACCAGTAAAGCACGACATTATCGCGCTCATTGACGGAGAT
ATGGTGCTCTTCAAGCCACTGGAAGTGAACACGGGTCGGGATGTCACCAAGTACTACCACGGCAAGCGAGACAAAGCCACAGTGAACGACACGGTGGCGG
ACGGCATCGCCATCGCGCAGGACTGGCACAATTACCTCAACTCCGGTTGGTATGCCGCCCACGCCCGAGATAAACTGGAGGCTGTCTGCGCTGGCAAACC
TTGTATCAATGTGACTCGCGACGATGCGCGTGAATACTACTCCAGTACGGGACCTCCGTACATCATGACGCGGCACGACATGGAGGCCATGATTGACGAT
TACTGCGACTTCGTCGTGCGTGGTCGGCAAGTGGAACAGGCTTGGATGGTGGAGATGTTCGCGTACACTCTGGCTGTAGCAAACCACGGCATCAAGCACA
CACTGTTGACAAACCTGGGAGCGACCCACCCGAAACTAGCAGTGGAAGAGCGTGAGTACTGGGACTTTGTGGACGACACACTGCCGAACCCTTGCGAGAA
CACGTCCGCGGTCGTCATGCCGTCCGATCCGCCGGTAGGTATCCACTACTGCCAGAAGTATGGCTTCGTCGAAGGGGACCACAAGGGCCACTACTACTAC
AAGTACGATCTGCCCGAGACACTCGTGAACTGTGATAGTCCTTTGCTGATGGTGCCTCCTACATCCGACTGGGATGCGCTGGAGACAACGACGGCACGCG
AGCTGCTAGCGCAAAAGCGGCATGAGGTCTGGGTCGAATGCTCGACTACTAAGATAGTCAACCAGGCAATGGTTAAGTACAAACAGCGCGCCTGCCCCAA
CGGATACAACACACAGCAAGGCATTGAGATGGTTAAGCCGTAGACGGTCTTCGCTACAGACACGAAGAACATTATATGATAGCAAGTCGAAGTAGCAT