Description :
From Genome Similarity Track
Location :
scaffold_23:328650- 330131
Transcript NameFunction/comments
g9963.t1 hypothetical protein PHYSODRAFT_498306

Sequence
1481 bases(100 bases per row)
CGAAGCCAGACATGGAGAACGGAGCCCTTCGCGAGGGAAAACCACTCAAGATCATGTCCATCGAGTGCATCGGACTGTTGGCACAATACGCTGGAGTCGG
CTTCCTTGCCGGTATCATCCCTGGTGTCATCTACCCCGTGCTCCAGGGATACCTGAACGCAGAAGGAACCACTGTCACCTCGGCGACAGTGCTGGTGCAG
ATTCCGTGGTGCTACAAGATGTTCTTCGGTGTGATCAGTGACTGCTTCCCGATCCTGGGCTACCGTCGTCGCCCGTACATGGTCATTGGTTGGTTGTTTT
GCATTACGATTCTCTTCGTCATGGCAGCGATGAGTATCCCTGACCCGTACTACGGCGACGCTGCGATGCACACGATCGATGAAGAGGACTGGACTGACGA
TCAAATCGACAGCATCAACGAAAGCGCCCCGAACTCTGCTGGCAAGTACGTGGTGCCCATGATGCTCGCTTCCTTCGGATACCTGCTCTGTGAAGTGGCG
GCAGATGCAATGGTCGTCGAGTACGCTCAGCGTGAACCCCTCGAGCAGCGTGGTCGTGTGCAGACTGCCGTGTACGTCGTCAAGACCTCGTTTACAGCTA
TCGGTGCTACTGTCATCGCTTTCTTCATGAACGGAGAGGAATATGCCGGTTCGTTCAGCTTCTCGCTCTCGTTCCAGGAGCTCATGATGATCACGGGCGT
CATTTGCGCGCCGCTGGTTCTCATATCGTGGTTCTTGCTGAATGAAGAACGTGTGACGGACAAGCCGTCTGTCAGCAAATACATGTCGTCGTTCTGGACA
TTGTTGCAGAAGCGTGCCATCTACCAGATCGTCGCGTACAAGTTCTTCTCGGGCGTCTTCAACAGCTTCAATATTGTATCGTCCAGCAACATCAAGCTGT
ACTGGGTCCATGCTACACCGTTCAACAACAGTTTTATGACCATTGTGGGCACGGTCTTCTATGCCATCACCTTGGCTCTCACAGGCAAATATGGCCTCGA
CTGGAACTGGCGAACCATCATTGCCGTTACCATGTGTGGTGCACTGTCCATTGATGCCTTCATGACCATGTTCACAGTGTGGGATGTGGTTCGCAACCAG
TGGTTCTGGCTTGGTGTGCCTATGATCGAGTACCTGCCCGACGGAATCCGATTCATGATCGCGACCTACGTTGTTGTCGAACTGGCTGAGCCTGGCCACG
AGGGTGCTCTGTACGGTCTATTGACTGCCACTACGAATCTTACGACCCCGTTTGGTCGTTCCATGGCCAAGCTGGTCAACGCGCAGTTCCACGTGTGGCT
GAAGGACATCCAGGCCGATACAACATTGGTACGCCGTGATGTTACCATCACGATCTGGATTTGTTACAGCATGAAGCTGCTTTCGTTGGCATTTCTCCCC
TTGTTGCCTCGCCAGAAGGCTGAGACGCAGGAGCTGAAGCGCACAGGCGGCTCCAGTCGTACGATGGGTATCATCACGGTG