Description :
From Genome Similarity Track
Location :
Scaffold_344:3286- 6969
Sequence
3683 bases(100 bases per row)
ATATTCAATGGCTGGAAATTCGTCGACCTCATCGGCGATAGCCGGTGTCTGAGCCAGCCGTGCCAGTTGTTGATCCACATTGATGCCAAGCGCCTGCAGT
GTTGTGTTGCCCATCAAAACTTCCTCTCGGCTCGTCGGCATCACCAGACACTCCACCCCTGCCGCATTCACCACACCAGCGCTGGTCACCAGTTGTAAGT
CTAGCAATGCGCTCATCGTGCAGTCCACTTCCGTGTCATCTGCCAGACTCGTCACCACTGGAGATGGCAGACGCTTGACCTGCAGCTCCGGCTGCAGTGC
CTGGAGCTCCTGCAGCACAGCCGATGGGACAATTGTCCAGTCAGATCCACTGTCGGCGATGAGTGGCACTGTAACCAGGCCGTTCAGCAGCACCTGCGTG
CTTTCGGCACCCCCAGCGTCTAGGCCAACGTGCAGCGCACGCGAGCCTCCTCCACCAGGAGGCTAGTTCTTCTTCTCTTGTAGGCGGTCCAGCATCTCCT
TGCGCTGCGCCTCCGTGAGATTGGGGCAGTCCTTGACCCAGTGAGGACCCTTGCAGCTCAGGCAGCCGTTGCGCGGTGCCGATGCGTTTGGCGTCCGCTG
CGGATCAGGCGCCCGCCCCGCTGGTTTCCTCTCCTTCGACCCCTTCTTTTTTTCCTTGGGTGAGGGTGTTGAGCGCTTGGGGCCATCTCGCTGCACCTTC
AGCTCTTGCGTCTGCTTATGGAACTTGTGCTGAAGCTTAGCTTGCTCCACGATCAGCTTGTAGAGAGCTCGGTCATCACTGCGGCAGGTCCGGGCCTCAA
ATTCTACCAGACGCTGGACTTGCGTGCGCAGCATCAACGGCTGTAGATTTTCAACCAGCAGCGTGCAGCGTGTCTTCATGCGAGCTCTAAATGAGGCATC
CTCCGTCCATTGTCTCGCATCGCGCTTGGATTAAACCACGCAAATCTTCGTCCGTCACCTCTTCGGACGACTTNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGGGCCTTCATAATCAGCCGGTAACCTCTTCCTCTCCGCGTAAACCGAGT
CCATCGTAATCGACACGATCGAGCTGATCGACCAACCTAATCACAACGATGTCGCAATTTATCTAGATAGGTACTTTGTCCTCGCGTGTGATTTCCGTGG
GAATTATGGCCAGTTGTCCATTTGTCATGCTGTCACAATGCTACTATTTTTTATGACGCTAGATGACAATATTTGGGGTAGCAAGTTGTGTAGATTTTTC
AGTGTCAGCATAATTCGGCGGGTGCTTCAGCTCCGGTGGGCGCTGTTTGTGCCTAAGGATTGATGTTGTGATGAAGGACATGACGATACCTTTTCAAATT
CATCTGAAATTAGAAGTTCAGTTTTGAAACTTATTTTTAAAGTTTCTTATTGGTCATTAGCACATTTATTATTAGGTTCGATTGGACAATGTCCAGTTGA
GTACCCTTATACTGAATTTGGTTTTATATACATGTATGTAAAGCATATGGAGCCACTATCTTTGGTATGATTTAGCATCTATATACGGACATACCAAAAC
CGTAGATACATACTATTGAGAGTGAAATTTAAATCCAAAACGCTATTTTCTTTGGTTCCGGAGAATCATATAGCAGAGTAACCTTTCTATGTTAGTCCTT
CTACTACGAACAGACGATCCCGTCGATAATCATAGCGTTGGGAGCCGCCAATTTATTCCTGTCTAAGGGCATTCCTATCCATGAATATCACAAAAATGAA
TCCGTGTCCTTCAGCTTGGAACAGTACACGAAATATACGATTGATGTAGCTCGTTAATGGCGATTCACCCTGTTTTATCCTCCTATTGCCAGTTTTGCCT
CACCACATTAATACACCCTCCTCTCTAGCCCATCCAGTCCACATCACAGTCACCAATACTCATCGACTGGAATACAAGTATGCAATATGTATCACTATGT
TCACATCCCTAGTTTGTCCCAAACAAAGCTAGATTTATGGGCTCACAGAATCTACGGTTTTCCTCTGGTTTATTACAAGCAAGGCTCTGGAAGCTATTGA
TGCGCAGAAAAGCACTGGACTCACTTCCTGTCTCGCAGTTGACATTAAAAAGACATTTCTAGTGGGTTATTGTGCTGAGTCATGGCAATCAAAAACGCGC
AAGGAGAGGCCCCCTGTGCTGTTTTCACTTTTTTTTCTGAACGGAGCAGATCATGGTGAATGTGTACATATTTGCTTTTACTTTCCAGCGACAATGAGGA
CAGGAAGTCCGGAGGAAAACGCGAAGCCTTCTAAAAAGGCCATGAAAATGCCCCCTACCTTTCTTGTTGGTACTTTCTAAAAGAATGAGTAATAACCACA
CGTTGTGAGTTTCCCATGCAACAGTCAGCTCCTGAATCTGACCTCGCGTTCACGAGATACCACAAACTAAATATTTAATGCATATACATGTGAAAAGGAG
AAGTATTTAACAACGTAACGCATAGGATTACTCAGCTTATTGATCCTATGCGCTGGCGAAAGATACACTAAGAATTCACTGCAGTACACGGTCCTTCGAA
GTGTTCTTCTATAAAAAAAAAGTACTAGGTACGTTTGGAAGACCACTGTATGAACAAACTCAGGACTATGCGACGTAAGTTGCCGGTGCAGGTGCAAGTA
TGCAATAATTCAAGCACCATGGCTCAAGAACAATGATATGGCGCTCACAAAAAGACTGAGAGCTTTCCAGACAACTAATAACCGAGATAGTTAAATCGAC
TATCATTGCTCTCGCAATTATGCAATACAAAAAACTAGCGCTTTAGAGTAAGTCGACTCCGCTGCGATGTGCTGTGGCGTGTCATATACGATGATGTAAT
TGCCCAAAACAAATAAATAAAATTGTTGCAAGGCCATACACAGCCTTTAATATACGTGTATACATGTACTCTCGACATTTGCTGTTCTCGTCTAATGTAG
CCGCAAAATACAATAATCATGTTACAGATTTAAGTAATTGCTCTTTTTGAAAATGTGACTGACAGATTTCGGTTTTCAAAGCAACACAATTGCAATATGG
ACTTGCACAATTGCCCACTACTGTCGTACCCGATCCTTAGCCGATATCAAGCGCATGACAGCGAGTACAGTGCGCTCCAGCTA