Description :
From Genome Similarity Track
Location :
contig_58:32851- 34889
Transcript NameFunction/comments
g8830.t1hypothetical protein

Sequence
2038 bases(100 bases per row)
CACAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTATCTACCATGCACTGCTTGGTCCTGGGTTTCACCCGCGTGCTTCGCACACGGCTTC
AAACCACAGGCGTACTCGCTGCGCTCGAGGGGAATGGTGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTC
ACACGAAGTCGCTGCCTACGCCCTCTCGAACAGCTGTCGGTACACTATGCTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAAC
GCCTTGAATCTCGATCTGACATAACCCTTGACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGT
TTGTCCCTGCGCCTTGTTGATCGTCATGGCAAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCATCGCTG
ATGAACACGATGCGGGATCAACACATGCTGGCCTTGCCTGTCGCCGGCCATGATAGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGG
TTCCGTTGCACAACCCCAGGTCAGGATTTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTT
CAGGGAGTTTCCTGCTTGAATAAGTTCCCGTCCTCTTCATCCTCCACTGAGTCTGTGGACACATATTCTTGAGATGGCCCAGTCATACGATCCGCTACGG
CTTCGTTGATACGATGGACTATCGCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGATGCGACTTCCGAATTGTTGATGTCGGCGTA
CATCTCGTCGATCATGCGCCGCATACCTCGCGGAATAGCTCCCGGTCGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGATGGAATCT
TAATGTAGTCATTTCCCAGATCATTGTGTACCTCGTGTCTCTCCTCTCCAACGTTCAGCAGGTACTCAGAAAACGCAGCCATTTCTGAAGCACTATCGGA
GGTGGCAGCCGTATGTTCTTTGTCAGACGCACCTTATGGAAAATGGCCACCGTTCGGATGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCC
CTTCACCACCTGGAGAATTTGCCTGGAATCTCTCTGAAACTCGACCACGTATGGGAATGAAAAGAAACGTTGTTGAAAGGCGGTGTATTTTGTCCAATCA
GCAGTGATTTCATTCGGCTACTTCCGATGTGATGTAGTCCACTCTACGCATTATAATAGCCAATCGCGCAGAGGCTCCACTATATAGCCAACGAGAGGCC
TCATATTATAATTATAGCGAATAGGGAGGCCACCTTCGCTGCGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGACTTGCGTTACGGTCCGGGTGCG
TACGGAATGACGGACAGACGGACGGACGGACAGGTTACTCTGTTACTTGTAGGGGATACAGCCACTCGGGTCCACCTTACCGTGCATAATATCAGCGCCT
GTCCGGCCGCCCATTTCACAAGCCAACAGACCGTCGATGGCTGCGTACACGTTGCCGGGTGAGAGCGGTGTAACACCACCAAAAGCTTGAATTTACGCAC
CCACAGTTAAGGCGGGCTCACTCGAAAGAGCGTGAACAACAACCCTCATAGGGAATGCAGTGACCAAGGGGGTGGGGGTCAGCACCCAAATCGTGGAAGC
AAATCACCATTATTATAGTAGGTTCTGCATCACAAACACGAGCATTCACTTCAATCGTCCAGACAAATCGCTGAGGATGGTGAAACTGGGGATTCGAAGA
ACGCGTGAGCGCCATCGCGTATCTTGTGAATACTACTGATTCTCCTATAGTATTGATAATTCCTTACCAATTGATTATCGTGCGGGATTGAATTGACTTG
AGAAAACGTAAGTCCCGCATGCCGACGGTTAAAGGGTG