Description :
From Genome Similarity Track
Location :
Scaffold_426:3285- 4388
Sequence
1103 bases(100 bases per row)
TTTCGTGGAAATCTGCTTCCCGCTGCTCGTACAACACTGATGCGTATAAAATTGCGAAATTTTCAATAAATCGAATGTAATAGTTAAGACTTCCCAAAAN
NNNNNNNNNACCAGAAATAACTGCATCGATCGCAGCGTCAGATGGAACTGAATGTTCACCAATGATTCTAAATCTTTTGGATTAGCTTCCGAACCCTGCG
AGCGAGATTTGATGTCNNNNNNNNNNCATCTATCGCAGTGTCCGAGGGGGAACGGGATGTTCACCAACGGTCCCAACTCTTTCGGATTACCTTTCAAACC
TGCGAGCGAGATTTGATGTCNNNNNNNNNNNCGCACGCCCCCATAATCTCTCCACTTTTTCACACATGAATTTCCGCGATGTAGCTGGTATCAATACGTC
TTCGATATAAGATCTTCGAGCCAACACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGGCCGTGCTCTATTCGGATCTTGCGCCGGTTTTCAGATACCCATACA
GAGCATTATCGATCAATCGCTGGTAAATCCGTGAACCTTTTTAACCAGAGAGGCATCCGATCCGCAACCACTCAACCAACCCTGATGGTGCGATAAAGGC
TGGAAGCGCTCTTGCCCTTTCAGTCATTCCCACCACCCAAAAATTACTCGCCATGTCCAGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGTCGGATGATCTTGGCTGAGAGTAATCCTTTTATCAGATCGGCTTGT
TTCTCTTGAAATTTGGGAGCCACAGGTCTGATTTTCTGCGCGACCGGATTTGCCCCACCCACATCTATATCGCAAATGCCCCACGCGCCGCAGGTGGTAG
GGC