Description :
From Genome Similarity Track
Location :
scaffold_101:32847- 37789
Transcript NameFunction/comments
Pl_109741ATP-binding Cassette (ABC) Superfamily

Sequence
4942 bases(100 bases per row)
TACACAACGAAAGGTTTCATGACGTTGCAGACTCTTGTCGCTCGTTTCGTTAATTGCATGCCGGAATGGGACACATCGAAGAAATCCACCACTGGTGCGT
GCAAGCAAAAACTATCCACGGCTGTGTCCAGCACTGCCAACGATGCTCGCCTTTTTCACGCTGTAGACAGTGACGTGTTGTTGAATGCTGGGTTATCCAC
AGTATTTGGAGCAACAGGCACGTCTTGGCAGTCTGCGCTATCAGCAACTGCCCGTGAACAGCTTCTTGTACCCCTCCGCCAGGCTCCGCAGCCATATTTT
GCAACAACTGTGGCTCCTTTTCCGATTGATAGTTTTCTCTCAGCACCGTTCTACGATCAGATCAGCTCCGTCTTCCCACTTGTGTTCATACTGGCATATC
TCTATGCCATCTCGCGAGTGCTTGTGGTACTTATCCAGGAAAAGGAAACTAGATCACGTGAATACCTCAAGATCCTCGGCATGTCTGAGGGTGCAATCAT
CCTGTCGTGGTATATCACGTACATGATCATCTTTACTCTGAGCGCCATCTTGCAAGCAATTGCTAGTAGCGCTGGACTCTTCCCGAACAGCGATCCTATA
TTGATCTTCATTTTCTTCCTGCTCTTCTCGCTCAGTGTACTTGCCTTTGGGTTTTTCATGAGTACTCTTTTCTCCCGTTCGCGTACAGGTTCATTTGCCG
GCATGGTACTCTTCTTCTTCATGTATTTCGTATCCAGTGGTTTCTCGTCAACATCGTCGATTAATTCCAAGACGGGAGCCTGTTTGCTACCACCCGTGGC
GCTGGCATTCGGAGTGCAGTCACTAGCTACGGCTGAGTCAACTGGTGTAGGTATGAGCTTCGCCTCGTCCAGTACAGTTGTCAACAACTTCAAGTTCGGT
TCTGCTATCGGAATGCTGTTCTTCGACATCTTCCTCTACACAATTCTGGGACTGTATCTCGAGCGTGTAATTCCACGTGAGTATGGCACTGTCGAGAAAT
GGTATTTTCCTGTCCAGCCCAGCTATTGGGTGCGTGCTGTACGCTCGAAGAGCAGTAGCAAGGTTAACGATGTCACCAGCACTGTTGTCTACGGCAGTCA
TGCAGTTCTCGACATCGAAGACGCTAACATGGAGCTTCCTAGTGACGAGTTACGCCACCAAGAGCGCTCAGGAGAAGCACTTGTGATCCGTGACATCAAA
AAGGAGTTCGTCGTTCCAGGAGGCATCAAGCGTGCCGTTCGAGGTGTGACTCTCGCCATGTACAAGGACCAAATCACTTGTTTGCTTGGTCACAATGGCG
CTGGCAAAACTACTCTTATTTCGATGCTCACTGGCATGATAGCACCTTCAGCTGGTGATGCATCCTTCAGAGGGATGTCGCTTGTGCATGACATGGCAGA
AATCCGTCAATCGTTGGGGCTTTGTTTCCAGCATGACGTGCTTTACAGCGAACTCACAGTCGAGGAACACTTGCTCTTCTATGGACGAGTGAAGGGCTAT
CACGGCGCAGCACTCCGAGAAGAGGTAAATAAGAAGATCACAGAGGTAGGTCTCACCGAGAAGCGACACGTCTTTGCTGGTTCACTTTCGGGTGGCATGA
AGCGAAAGCTTTCAGTAGCTATTTGCTTGCTTGGCGACAGCGCACTGGTGTTCTTGGACGAACCAACTTCCGGTATGGACCCGTACAAGTCGACGCAGCA
CCTGGGAAATTCTGCTTTAACAACCGAGCCAACCGTGTTATGGTGCTCACGACTCACTTCATGGACGAAGCTGACATCTTGGGCGACCGTATTGCTATCA
TGGCTGAGGGTCAATTGCGCTGCTGTGGTTCCTCACTCTTCCTCAAAAATCGCTACGGAGCTGGATACAACTTCACACTTGTCAAGAGTAGTGACCCTGC
TGCACCATGCAAGGAAGCACAGCTCCAATCGCTTATTATGGCACGTATACCTGCAGCCAAAGTGCTGAGCAATGTCGGTGCTGAAATCGCTTTTCAATTG
CCGCTGGACAACACGGCTTCGTTCCCACAGCTTTTCGAGGAACTTGACGAAAAAATGACGGGGCTGGGCGTGCTGTCGTACGGCATTTCAGTCACAACAC
TCGAGGAGGTCTTCATCAAAGTAGCAGAAGCACATGATGAAGACAACCAGCACACGCTCAGCAAAGATGGCGCGAATCCTAATGCTACTAATTCTGCTGT
GCCACCGGGTGGTCCATCAATTGCCGGTTTAACCGGCCTAACGATGTTCCTTGTCCATTTATCAGCGCTGCTACTCAAGAGATTTCGTATCGCAAAGCGT
GATCGACGAGTTATCATCTTCAGTGCATTGTTACCTGTGACGCTGCTTGCCGCCGGATTCATCATCCTCAAAACCAGCTCACTTACGCGGTCTGACGTAA
AACTTGCACTCAACACCGACGATTTTGAGATTGCAGTACCCAGCGTGCCTTACTTCTGCGAAGCTGACGACTCCAAATGGTGTTCGAAGACAATGGACTC
GCTCTTTACGGGTGGCAATACGTCTTCTTTTACGAGCGCCGACATAAATTCGCCTCCATACACGCAATGGCCCGCCACAGTTTTTAATGTGAGTTACGCT
GAAGCAGATCTCACAAGTTCCAGCAATCCCCATAGCAACGAATACTGCCTGAGGATGGGAGACAAAATCTACCAACGTGGTTTTGGAAAGACGGACGATG
AGCAAACGAAGGTCACTCAAACCCCTGTCAAGGGGCAGTACGGTGGCTATCTCGTTCATGGCTCTGAAACTGAGCAAATATTTGGTTATCATCTTTTCAT
TAACACCACTGCAGCCCACGGTGCAGTGGTCTTCAAGGCCCTGATGGACCAGGCTCTTTATCGTTTCATGGCTGGAGGTGGTACTGATGTGACACTCAAA
GCAAATACTTTCCCGTTGCCCATGACAGCAGCCACCCAGGCACTCTTCGGATCATTCTTAGCATTTACGGCTTGTATTTTCATCGTTATCGCGTTTGCTT
TCTTCCCGGCGTCAATCGTCGGCTTCCTTGTGAAGGAGAAGGCACCCGAAGCCAACTCAAAACACCAGCAACTCGTCTCGGGTGTGAGTTTACCAGCATT
CTGGCTGGCCAATTACCTTTGGGACTTGCTCACATACGTCGTTCCGTTCATTGCAGCTATTGTACTCATCCAAATCTTCGACATTGCTGCTTTTACTGGT
AACGACTGCGTGAGCTGTACCAGCGAGACATTCCCGGCTATTGTGTTGCTCTTTATCCTCTTTGGGCTGGCGATATGTCCCTTTACGTACTGCCTCTCGT
ATTTTTTCAAGGACCATGCATCCGCCCAAACATATACTATCATGGCCAATTTCCTGCTTGGTGTCGTGCTGATGGTAGTGTCCTTTATTCTGGATGTCGT
CAGCGATAGCAGCAAAGATGCCAACCGAGTTCTCAAGTTCTTCTGGCGACTCAGTCCACTGTTCAATCTCGGTAGTGCACTGCTCAATCAGTGCCTCAGT
GAGATTGGTGCTGCCTTTGGACGGTCATCAGGCACTATCAGTCCTTTCAAGATGGATATCATGGGCTGGGAGCTGCTGTATCTGACGCTGGACGCTATCA
TCTTTTTCACAATTGCCGTAGGCATCGACTTTTTGCTGAGCTTCCCCAAGATCAAGGCTGCTGTCTTCAAAGACCCCGTTTTGAATGACGCACCTTACGA
AGAAGATGAAGATGTGGCTCGAGAGGCTGAACGTGTACGAAGTGGCAAGGCCGACGGTGACGCTGTGAAGCTCCTTGGGATCCGCAAAGTATATAAAGGT
AACAAGGTGGCCGTACGAAACCTGTCGTTCGGTCTTCCCAAGGGTGAGTGTTTCGGCTACCTGGGCATTAACGGAGCAGGAAAGACGACAACCATGAAAA
TGATGACAGGTGACATCCTTCCAACCTCGGGCACCGGTAAGCTTGGAGGTTTCGACATACTGAGTGAACAGCTGGAGGTTCGCCGTTTGATCGGCTACTG
CCCACAATTCGACGCTCTCTTCGAGTTGATGTCTGTCCGAGAGCACTTGGAGCTATTTGCTCGTATTAAGGGAGTAGCGCGAGCAGATTTGAACAATGTG
GTGAAGTCTCTCATGCACCAGATGAACTTGGATGACTTCGAAAACAAACTAGCAGGAACACTCAGTGGTGGCAACAAGCGCAAGTTATCCGTTGCCATCG
CTCTCATCGGATCACCGCCAATTATTTTCTTAGATGAACCTTCGACCGGCATGGACCCAGTCTCGCGTCGATTCATGTGGAATGTCATTGCAGCCATCTC
CACGCAACGCAAGGAGTCGACGATCATCCTCACTACTCACAGTATGGAGGAGTGTGAGGCCCTCTGCACACGCGTTGGTATCATGGTGGGTGGTCGTCTG
CGTTGTCTTGGCAGTGTGCAGCACTTAAAGCATCGCTTCGGCGACGGCCTCATGCTTGAGCTGAAACTTATGGGCACACCAACACATGACATCGATGCTC
GCGTGGCATCCATGTTTAGTGGCAGTGCTTCGACGACGACATTTCCCCGTGTCGAGTTGCGTGAGAAATGTGAGGCACTTGGCGACGCATCTTGGGCTGA
CAAAATTGTGATGAGCCATGCCACAGGATATGCATTGGCGACAGCACTTGAACGTGACGGAACCATGCGACTTGGCATGCTTTGCGCTTGGTGGGCTGCT
GAGGAACGATTCTTGGCTTTAGATACATTCCTTCGCGAGAGCTTCGCAAGTAACGCGAACACTGGTGTGAAGCTACTTGAGCGGCAGAACGACCTCTGTC
GCTACAAGCTCACGGGTCAGGTACCGCGCTTGGCAACCGTATTCAGACGTGTCGAAGGTAGTAAGCAGCAGATCGGCATCCGCGAGTACGCAGTTTCACA
AACCACGCTTGAACAGATCTTTAACAACTTCGCAGGCCAGCA