Description :
From Genome Similarity Track
Location :
Scaffold_165:32847- 43585
Transcript NameFunction/comments
Phypl_g4549hypothetical protein
Phypl_g4550conserved hypothetical protein
Phypl_g4551hypothetical protein PHYSODRAFT_471024

Sequence
10738 bases(100 bases per row)
GTTTACAAGAACGGCATCCACCCGATGTACATTTGGGCGAGGTTTTCGTGCGACGTGGCCTCATGGATGAGCTTGTCGACTTGACCTTGAACTGAGAGCG
GCAATGTTTCAGTTTCTGGCAGGATGCTGCggtgcgacgacgacacaaGCGGGCGGATGGCATCTCCCAGGTTGTAGACGCCTAGCAGCCGCTCGTCGAT
AGTCTTGAGCACAAGGCGCGTTTCCTGCTTGCTACGCTCACTAGAAAGCTCGGCAGCAGATTTACCAGAATTAGCGCTGCTCTGGGTAGCTTTGCCGCGA
CGACCCCACTCGACGAGCGGGTCGTGGATGAAGGACTCCAGCACACTCCGCAGTGTCGCCTTATTCTCGCGCAGCAAATACATCGTCACTTCGCTTACCC
GACGGAATACACCTTCGCACCCCGCGATCCCAAACGCGTCAATGATGTTGGGCGTCAACCGGAATGGCACAATCTCAGGCTTTGCCAGCTTGAGGCCCTT
GTCGAATAGGCAGTCAAAGTCCACGTGTACACACTCGCCGTTGGTGCAGTCGATCAGAATGTTTTCTCCGTGACGATCACCGAGGCCGACGATGTGCCCC
ACCATAGACCACACGGCTGCTGACCGCGTGAACATGAGCCGAGCCTCGAACCATGCTGTCGGGTCGGCAAAGTTGTTGTAAAACCACTGATGAAACCTTG
GGGTGAAAACCGGCTTCGACAACACCTTGCAGCGGTAGTACCGCGCCATGGCTGGAGGGTCATTTGCGTACTTCTTCTGCATGTTCAGGTACTGTTCCTT
GATGTCATGTGTCAGCCGAACTGGTTGTATGTATCCGCGCTCCGTCTTGTGGATCTGGCCGATGAGCTGCCGCATGGCCTTTGTGTGTCGCACCCACTCC
ATCAGCCCGCTCTCTTCATTCAGACACACGACGGCGTATGTTCGCAATCGCAACTTGCGCTTGCGACCTTCTCGGTCCTTCTGGAGGAGTTTGTTAATCA
TAGAGTTAAACTCCATCATACGCGCATCCTTGCGAAGGTCGCCAGTCTTCTCACGCTTGCACAGGAATGGATACAATTGTCCGTCGGTGCCAAGAACTTC
AAtgcgcttgggcttctcTTTGGTCATCATCACATCCGCTTTGTCGCTAAAAGCTTTGATGTAGATTTGTGCATTTGACGAGAAGGCAACATGAAGCTCA
TCGCGAGGAGCCAACCCTGACGTCGGCAGGATCGTGGTCAGAGCCGCCTGGATCGGAACTAGAATTCTAGTCCGAATCCGGCTCAGTCGAATGTGGATCT
TGCGCTGACTGTTACCGGGGTCATGGGCTGCCAGACTGATAAGCTCTTCCGCCATTTTCACCCCCTCGGAAAAGCTGTCTGCAATCTCTTTCAGACCCTT
CGACAgaaactgctgctgtgcagTCGAGATGATCTCACGCGCACGATTTCGCCGCTGGGGGTTCAATGATCGCGATAGACCGAGTAGTGACCACATCGCT
TGCGTTGGATAAGCCAGGAGCACTCGAACCATGATTTTCTTGACACTGGCGACTACAACCGGGTTGGGGTGGCAAATACGCGACGTTACTTGCGGAAAGC
ACACCAGCCATTCATATGCTGGCAAGGACTCGGCAGCTTCATTCACAACTTGAGTAATGTCGTCGAGAACTTTCTGCTCATCAGTGGCCTGGCTCAGCCC
GATCTCAATCTGCCTCAGAGCCTTGTTCGCTTTGTTGCCTGGTCGCCCACTAACACTTCCGTATAGGACCTCGCCATACTCGAACCACAGCGTTAACAGT
CGTGGAAGTGACTGAAACACAAACTTCGTTCCGTGCGCTAGTGCCAGCACATAATTCTTCATCAAGTTGATTAAGTGGGCGTGAAACACAGAATCAACCA
GAAGGCCAGCCGCTTCGTCACTACTCATTGACCCGTTTAAAGCGTCGGGGTGGCTCACACTCAGCAAATACTCGTAGTACTTAGCCAGGTAAAAGTACCC
TTTCTCCCACGTCGGATCAAAATGAATGACTGCTTGGTATCGCTCAATCACTTTTTTACCTTGACGCTGACCTGATTCCTGCATCCAGTTGGTCGCCAAA
AGCAGGTTCTTGGCGCAAAAGTGAGGATCGTCAACATCAAAGTCCAACGTAGATGCGTCGATATCAACTGGTTCAAGAATTTGCAACGCCTCATACATCC
GATCCTGGCTCACGAACAGCTTGGCCTTTTCTATCAGTGCATACTGATTGTCCATTGCTTGAGCATGCATCACCGCGCTGGCAGCTGTACGAATAAACCC
TTCTTTTCTGGTTAACTTGGCGTACAGCAACCAATTTTCCGATACTTCGTTTCGGAGCCCCGCTTCGTGTAAAATTACTCGTCGTAGTGCAAGTATTGGG
TCACGGTATTTGAGCTGAGTTGCCATCGCATCATACCGTACTTTCCAAGGGGCCTGCTCTTTCCAGAGAAGACtgcgtcggccgagatcaTCACACTCCT
TCGCTTTCTGCAGAAATATGAATCCTTGCTCTGCCTCGTGTAGAAAGTGAAGATCATGCAGGAGAGGGTATGCACGTTGATATGACTcagccgacgccgc
tgctaGCGGTCCCATCACCTCTAGCCGTGCTGCTCTCAAGTGGCGCTGGAAGTCTTCTTGTTGACCACCGTTTAAACTATGCAGTACGCGAACCAGCATC
AGCTGCGAAACATCAAACCCCTTCAGCCGAGCATTTGTTGTGTTATCAGAAGAGCTGTCCGAAGCGTGAAGTAGCGGGTTTTGCTTTTCCGCACTAAGCA
GATCTGTCAGTAGATCCCATCGTGATAACCGCCATGAGCACTCAAGCGCATAAGGATACATCGTAGCCATGAATTGAGGTTCTTGCGTGACTATGCCATT
GATATGCTGCAAAGCACTTTCCAGACGCCCGAGTTGGATAAGACAACCAATCATTCCAGCATATAGCTCGGGTTTTATCATATCTGGATCTTTGTGTGCG
TTTTCCGCATCCAAAATCTGCGCAGGAGGCTGCATCATCGCAAGTTGACTATAAAGTGGTTTGCTTGGAGGCATCGACCTGGACGACAATGCAGACTGGA
TTTCTTGGATTGCCTGCTCGTAACAAGCCAGCGCGTCTTCCCATtgagcaagctgctcgtgatCGACAATCTGATGCATCAGATCAGTTAGGTTCAGCCC
CTCGTCTTGAGTTTCGCCTTGCATGTCTGCTCCGTCATCATTGTGCCGATATGTATCGTACAAGCGGCGTAACGAGGCTAAACCGATCAGCGCATCCGGT
TCGTCCACGCTTTTGTATAGCTGCTGAAGATAAATAGCATTCTTCGAGACCAACGAAAGACGGACGGGGCCGGCCACCTCGACATTGGTACTTCTTGTTT
CTGTCGCTTTAAACTCTTCCTGCCGTAGGTGGACTTCGAAATATTGGATTGCCCGCGCATACGCTTTGATTTGGTATGCCGCATTTGAAAGAGATCGACT
GGGAATACCTTTAAGAAACTCTTCCAGATACTCTTTTTCATGATCATCGATATCGGAAGCTACGTCGCTCCGACCAGAAGCAGACGTTTGGCGACTTGCA
GCACTGCCACTTAAAGCTAGACGTTTCTTCTCGCTAGTCCAAATCCATTCGTTCAGCTCATCGATCGTCGAAAAAATGGTTTGAGAGCATTGATCATGGC
GACGAAAGAATTCGCCAACGGATTTTTCAGACGCCCCACCAGTGCTGGTGAGCGAGTCATTTGTGTGCTCTGATTCAGGCGGAGCCATTAGAACATCATC
CATCAAAATACCACAATTTTGGTCGTCCAAAACTGCCATGACTTCtttcttgagctcttcgccaACATCAGATTTTCCGGACCGGAGTACATTTTGAATT
AGATAAGGCAGAAAAAAGCGGGATATTTGAGGGCATGTTGGAAGTGCAGTTCTGCAGGCCCAAAAAATCTTCCTCTCGGGCGGCTGAGAAAGATTAATTA
ATCGTCGGCACCACATCAATATCCATTCTTCATATGAAGTCCCATATTTTTCATAAAACGAGATGTCGTCTTGAGGCGGCTGCAGGTTCCGATCAGCGCT
TGCTGACGAGCGACGGTCAGATCCACTGCTACCGTTGCGGCGCGAAGAGCGACTGCCGGATACGGTGTAGTTTGTTGACCAATAGGGTTCAACAAACTGA
AGGACATCTTTCCGTTCAAATCTTCTTTTCATCCATTCGGGCATGGGGGCGCTGGGATCTTGTCTTGCCTTGTACGATGAACCGAAATTATTCGTTGATG
CCAAGCTTTGACCGCTATGCTGTGGATCCGCCGTCAATTCTGCCAAAAATTTCAGCAATTCTTGGATAGCGAATCCTAACGAGTCCGTATTTTCGGGTGC
TGAACGGAGCTCCTTTACCAGCCATTTCTCGATCAGTACACACGCTAAATCCTTTGTTGGATATTCGATCTTTTGGTACTGCTTTTCTTTTGCGACTGAT
GTGCCTCCTTGAGGCCCAGATGTGTAAAACATGTTTAACGGCACCCGGGCACCATCAATGGCACCCAAGGCACCCAAACATCGAGCGCAAAGCAGCTTGA
TTGGTTCATGACTCTCCGTGAGAGAAAGCTGCAAAATAGACTGCACCACGCTAGCAACAGCTCTGTCAATAAATATATCTCCTTCGTTCTGCATTAGCGC
CTCTAACTCGGCGCCACGCACAACTAAACAGCGTagcagctgcgtgagcgccaTTTCACGAACCGCTGCATCAAGATGATTCACGTACGCCGACAGATTC
ATTAAATATTCGCCCAAGGGCCGGCATCTTGGGTCTCCATCTTCCTCGTAAAGAACAACGTAAATCTCATCGAGTTCTGGAATGGACGGTAGCAACGGGA
TCTTTGGAAATGATGGCTTCAATTCGGCTCCCTTCTCGATAAATAAGTATCGTAAAATACCCACTGCCACAGCCATACATTTTGTTTCAACTTCGCATCG
GTTACTTGGTGAAATCACTTGTCCAGGATCATCGTGCCTAAAATGCTCCAGAGACTCAATATTCCAACATGGGCTACCACTAGTAGATCCATCTTCAATC
AAAATTGCTGCGGCTTCATGACCGAGGCACGCAAGCAAGCTGACAACGATAGAGCTTAAGTTCGCCTCTAAAGCTTTTGTTGACAGCATTCGCAGAAAAT
TCCCCCACGCATGAATGGCATGCTCTTGCAATTCCTGTTCTGTAAGACCGACTTTAAGAGTTGCCATCACTTTAGGAACAAAAGGATCGACGACTCCATT
GTTTTGCGTACTGTCCGGGTCCGTAGAAGAACCACTGTAAAGTTCCAGCAAGCGGTCAATACTTTTGATCGAGCGAATCTTCACAGCGGACGAATTTTTG
CCACTAATTCGATTGCCTAGATCCGTCATGAGCGCCAGGAAATATTGGCGGGGCATGCACCCTTCCCGAGGCTGTAGGCTCGCTACTTGCTCGATCGTTT
CTGCCTCTCGCGAGTCTTCATTTAAGCAATTTGCAACCTCACGTATCGCTCGCTTAGCCATGCGAGATTGAGGACCACCAAGTTCCCATGCCAATAAACT
CATTAGTCGCAACGGAGAATGCGTGATTACATCACGGACGGTCGAGTTCTCAGGCAAAAAATTGAATAGAAACTCCCATTCGGCCAGCCGGTTCTTGTTC
GAGACTGCTTGCACCTGGTGGATGATCAGATCTCTTAGCACATAGTCGAGATAATTCAACAGAAGATTCGTGATATTCATCGGCGGTTCTTCATCTGCAC
CATTGTCCACCATTGTGACATCTTCCCCTGTCCCGTTAAATTCGTCAACGTACGCGTGCAACATCCGCTCATTTTGCTGGACAACGTATTTCGGAAGGAC
ATACGGTGCACTCACCTTCAAGAAAACTTTACTATCCACTTTTCCGCCCATGAACGTATGGAGAAACAACTTAAGGGTTCGAGTTTCCAGCagttcatcg
acgagagAAAAATAGAGCAGCTCAGGGAAATCAGTGCATAACTGTCTCCAGGACACTCGATGGTGCGCCGTAATGCGACAAATCTGGTCGTAAGCCATTG
CCGCGTATCGCGAGCGATTCGCAACCATGAATCGGTTCCAAAGAGATACCAGTCGTAAAAGAATCCACATGCAATTGTCCCCGCGGTCACCGTGCTGCGG
GTCACATTCACAACCAATTGAACCCGATGTCAAAAGCATAGCTGCGATGACAGCATCATCATTACTTTCTTCCGTCGCCGTCATGCGAGCCTCCAACCGC
TCCATGAGTCCAGCAAGACCATCCTTCACCGGATCTATCAtcgcgtcaagaaggcgaggCTGGTGAACAACCGTTTCCAGCACTGCTTGACGGACGAGGT
CAGAGCGATGTCCAAAGCATGCTAATAAATGCTCCACGAATCGCATAGCAGTCTGGTCATTTCCATAATCAACTTCGCAGTGCTCGAACACACTCGACAA
TGCGTTGATTTTGACCACCTGTATGCTTTCGGCAGCATTGCCTGTATCGCCACAAATTACCGGTTCGAACAATGCTAGTGGAATCGGCAGTGCTTGGCAG
CTATTCGAGTTCTTTCGACACTGACAACTTGTGATGCGACATTGGATGGCGCTATctcttctgcttctggaATGGTGCCCTCCCTCAGCGGATGCTTGAC
CGTACGCCGTTGCGCAAAGCACAGCCCCGCATGCTTGCGTTATTGCGGACGAAATCACATCTGACGTCGTGCGTTGAATCTTGCCACTAAAAGTTTCCAT
GATGCAGGTAGCCACCCTTTTCGGGGAGGTTAGTGACCCACCCACGACAAAGAAAGCGAGAAGAGGGATCATAGCAAGATAAGTACACACTGTCGCATCG
AGTGATGTTTCTAGCAAAAGCGCTCGATATGCAACCTTCCATGGTAAAGCATTCCGCCACGCATCCTCATCGACAATATTGAGCGTCACAGGACGTGACC
ACACAAAGTAAACCAAGAATGGACCACGGAGGGCCACAGATTTCCGGAAAAGAACGTCGAGTACAGTGTCTGCGCTACGGAGGAAATCATATGACACTTC
GTCGAGTGTGTCCGATGGAGACATGTCGTGGCACTTGGGGTGGCACTGATACAGTTCTAAGAAATCCAGATACTCCCAACAGTCTGGAACCGCAAATGTT
TTTTCCCGCTCGACGCTGCGTGCGAAGATCTCCTGGGTCTCCACAGTCTCCACAACTTTCATAAGCAAGTCGCGATATTTTTCGAGCTCGTGATCGTCAA
AATATCGCAGCAAGATGATCCATAAATCCACGTACTCACTTGTAAGAGACGTGAGCGACGGCGCGTAAGTGTTCAAAACCAAATCGacacgctgaagaag
agctcgaaaTACGGCAAAACTTTCCAGTCGAACAAAGGCTACAATGTAGCGACGAAGAGGCAAAATCACACGCAAGCTAGTGGAAATTGCCACTATGCTC
TTCCGATCATTACCACTCCCGATCGAGATAAGGTCAAGTATCCATCGAGCTAACTTTTCGTGCAACTCGATGCTGTTCTCGCGGTGCACCCCTGAAGATG
AACTCTGTCTATCCGCAGAGATCTTATTTCGCTTTCGCTTCCTTGATACGTTGGCGTTTTGACTCGCATTCGGTCCATCGCTAACTAATTCCTTTGATAT
ACAGCGAACCACTTTCGTCAGCATTTCTTTCGTCGACAGCACATGGTGTATGCCACCGATGACACTTGAGAGCATTGCGGAATTCGACGCTTTTACATCG
AAATACTCCAGCAAATCCACGAACAACGAAGCGGAAGACGAAGTATTGGACTGACTAGTGTACACGCCCAAAATTGAAAGCACTGCCATCCAAATCATCT
CTTCATTGCCTTTGTTTTCACACCTAGCTCCGCGAATTAGATCCATATTTCCAGAGATCCACGACTCTAAAGGTGGCCATAGAGCATCGGTGGCAAACTT
AGAGAGGTGGGGATAAGTATCGCCAATCAGCTCAAGGATTGCAGCGCAGGCTTTCAATATCCGCGGGTTAGCTTCGCGTAAAAAGCTGAGTTGTAGGTAC
ATCAACGTTAACCGAACAAACCGTCTTTCGGTGGATACGCTGACCTGCAGCATCGTGTGCAACAGTCGAAGTGTACTTTGAGTAACTTCGTCCGCGTCTT
GGTTCGACACTGCGCCGTTCACGTACGCACCATCAGCGTTGTTCGCAAGCTCCTCGTTTTTGACGATAAACAGTTCCACAAGTTGGCATAACCTGTCCAT
AGATTGGTCTCCTTCCAGCATCGCGTTATGTTCGCGAATTATCCGATCCGCTAATGCAATCACCGACTGCCGAAGCGCCACAACTGTCCTGTACGAGCTG
ACATGAATTGACGGCAgcatctgcttcagctgctccCTGCGTTCGTAAAGTTGATTCACGTCGGTAATCGGCATACATCCACATAACGTAATATTGCTTT
TCGCGCCCAGCGGTCCATCAGCATCCTGGTAGACGTGGATCGCCGTGTCCAAATAGCAGGCTATGGTCACTCCACCAGGCAAAGCATCCGTCGAGTCTCT
GTTCTTCAGTGACTCCTCTAGCAAGAAGCAGTCCTCCAATAACTGCACTGTATCTCGGAAGAAGTGGATGAACCCATACACATCGTTCCTCTGCAGGAAC
AGCACCatctgcagcgtcacgttGCGCACGTctcgctgcgcctgctgcagcctcccATTTGTGTAGAACGACACCATGTAGAACAgcatcgtggccatcg
tcGGGTAGGACGGAAAGCCCGAGGCCGCCGGGTTGTCTCCGCGCGTGTTGCTCTCCATGAAGAGCGTCATCGAGTGCGGAcacgcgccgccgccaagcag
cagcgtcagcagtTGGCACAGGTCTTGCAGTACCGGCACCGCCTGTTCGGTCGACAGCGTTGCCACCGGGCGCATgagcttgggcagcagcttgcgtAGC
TTGGTCAGCATGGTCTTGCAGCGGCTGATGGCGGCGggcgcgctcgagtcgtaCGCGCGGTCGGCATGCTGGCGTTGGTGGGAGCGCACGAGTCGCAGTA
GGCTGTCCACGTCActcttctcggcctcctcggcgCTCGTGAGCGTCGCCATGCAGCCGAGTGCGCACTCCGTTTGGCGGCAAGTTGTTGCTCTATTCGA
ACGAGTGCTGCACTACCTCCCACTTAAGTACGTTGAAGtaggagtgatggtcacttCATCAACGTACTTAAGCGGAAGTGATGTGGTGTGGCACACATAG
CGGTCCCCCAAGCCAAACAATTCACGACTTCACTCTGACCGCACACTCAAGCAGAGACACCAGGACAGGATGGCGACCAAGGGTGTGTGGCAACTCAAGC
AGGTGACGATTCGTTACTGCCAgcacggcggcagcagtcgctacgtgcggcagcttctgggtgaccagcgcttcctccagttcgtggaggagaacCCGCA
GGTGCAGTTCGAGACGGAGCTCAAGGGCGCGCGCCACCCGATCCTCGTCGGAGACTACGGTGCGTACAGGCTTGGCGGCAGCAATAATGAGGTTAGAAAC
AAAGGTCCTAAACATTGTGTTAATGTGTTTATTGCAGTGACAAATGAGCGCAAGGTGTCAGACGTCAAGAACCAGGACATCCCCTTCATCATGAAGCAGG
TGCGGCTCGAGGCTTTGGCACACAAGCAACTATAGCAGTGTTGCATAGCATTGCTGTCGTTTACTGCTGGTTATCTAACCTTTTTTATATATTGGATATT
TGTTCTGAAGCTGGAGCGTCTTCGCAACTCTAGCGGCCGCAAAATGACGCACATCAAGAAACCAGTCATCTCGAAGCGTCCGACCATCCAGGGCATCTGG
CAGCCGGACCTTGACTTCCCGGAGTTCAAGATCAGCGACCGCACGTAGACGTCAATGCTGCTAGTCAGGGGGTGCAACTTCAGGTGTCAGGGTGTCGCCA
TtcctgtgctgctgcggattGCCAAGTCGCGTGCAGGAATCACAGCTCGTTTAGCAGGTATGATGGCCTACAGCTCTGAAGATTGCAATAGCAGTCCGCA
GGGCTCTCTCAACAAGTGAAGCATCAAATATATTCCTTCAACAGCTGCCGAGAGACAGGAAGAGAGGCCCGCCACCTCATCTCCCTCTCCTCTTCTCATC
TAACTCTTGTGGATCACAAGCCCgcagacgtcgtcgtggcgctgcaggccgcgGCAGCTAAAAGTTTCAGCACCTGGGTCCTACAACCGGCTTAGAAACC
GTGCAGCACCACCTGGGCGTCCGTGCAGATCTCTTGGTCCAACAGGAACTCGCGGATGTTGGTCCGCTGGTCGCCGGACAGCTGAATGatctcgcccagc
tcgtcgtccttgacgaTAGCGCCGTTGCAGCTGAAGTTTTTCTTGAAGGCCTTGAGGATGCGCTTcacgtccaagtcgtcgGCTAGGCCCTGCACGGTCG
TCAGACACTTGCGAccgttgcgctgctgcacgcggaCGTGAaccttgccgccgccgatgctcgagtcgtccttggcgtcggcgaagGCGTCTGCAGAGCG
GGAAAAAAAGTGGTAAACGTATCAGAACATCGCTCCGCATCTACCACACGGCGTAATACCCACAGCGTCGCCCTATTATCGCCACGAAAACGCACCGAAG
GTCTGGAAGTTCTGGATGTCGGCCATGTTCGCTACGTG