Description :
From Genome Similarity Track
Location :
scaffold_50:328443- 329719
Sequence
1276 bases(100 bases per row)
caaacgagccatcttgcttaaccggtcgacaaataccacgacacccgtgttgcccgccgaatctttcggcaggccaaNNNNNNNNNNAAaaagatgcaga
catcttctgctgcagatgctctagcagcgcgtcgtcgtaactcgaaaacgcctctagacgcgcaccgattgcctcggggccttgtgccgCAAgctgttgc
acgccctcagggccaagcaaggacatcagcttattatgcCCGTCTTACATGccttggggcaaagaggaaaatttctccatcctcacagaggatcagtcga
aacgactcaggtgtagattgactacaagtNNNNNNNNNNtgagtggcacgttattcactTGACGAAGACGGCGGTGTTAGCAGCGCTTCGTTGGATGTTg
aagataacatcggagctccaaaggagcggacagagGGGGtaacaccggacgacgcggagtgcgtgttcaccctggtctcaccgagacattgaacatctgt
acagaggccacggagacgccgtatgctgcctgtaagacgccgggcgtcgaccttgATCCAGGGTTTGTCTACCATAGACGACgttgcacagttatacacc
ttcgtcaacggtatgacgggggaggaagatggcgacgtccgcctcgaggctatgccttcAGTAGATGTTCttattgagctggacgagacgtCCCTTGACG
AGTTCGACAGTAAAGGCAGGCATTTTGGCCAACggggtcattgtacgaccggacgaggtgataaactcgtcatcgcttctggatgaagctgtcttggaag
gcacctagagagtgctgaacgcacgaagtggatcgtagATCCTACTAAATCCCTTAGGGTTTTTTACATTAGaaaaaggtcttcgacctaaAAGCTTTAT
ACGttgcctcttccttcttcatctgcatattctttctggcggtcttggctttcagccatcgcatcgcgaacgtgtcgtaggacactcagtctagtagaca
agaagtaattgacttctttgcggatggtgagggggctgacatcagctagccgttcggttatttctcccccaccaagccctgagctatgggatggcggcgt
cagtgggacgcgagggtgaaccagcccgttcacgtagaacggcNNNNNNNNNNGAAAGCGCTTTCCGAGCCTCTCCCCCACTTAAAACCCAAGACGGAGT
GCCTCCTCTANNNNNNNNNNTCAAGCATCGTTATATCCGGCAAATTTTTTATGTTCTCGCTGAATTGCTCACGCGA