Description :
From Genome Similarity Track
Location :
Scaffold_192:32842- 33854
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_192-snap-gene-0.18TTK family protein kinase

Sequence
1012 bases(100 bases per row)
CATTGAGCTAAATTCTGTGGTCTCGTACTATTTATTTTGTAGGCGACTTAAAGCCAGCAAATTTTCTGTTTGTGAATGGTGCTCTCAAGCTCATTGACTT
TGGCATCGCCAAGGCGATTTCGAACGACACGACGAACATTGAGAGAGACAGCCAGGTCGGGACCGTCAACTATATGTCCCCAGAGGCTATTCAGGGCAAT
GCTGCGTCAAACGGACAACGAAATCCATCAGGAAAAATGAAGGTACGCTTATGCCTTCGTTACAAAATTCGCTTGCGTGGATGTAAAGGTGGCTCTTTGC
GCTAATGTTGATTCTAATCACGAACGCGCAGGTTGGACGTGCCAGTGATATTTGGTCTCTTGGGTGCATCTTGTACCAGATCGTGTACGGGAAGCCACCG
TTTGCTGATGTAAACAGTATCATTGAGAAATTCCGCTGTATTATCGACCCGAGCTACCCGATTCCGTACCCATCATTGAAGAACAAAGAGCTCGAGAATG
TGATCCGGTCGTGCTTGCAACGAGACCATCGAGCTCGACCGACGATTGACGGTTCAGGAGGGCTGCTGAACCATCCATTCCTACGTAGCGGTGGCGTCAA
CGCGATGGTGTCATCAGATGCAGCCGCAGTGACGCTATCGAATGCCCCCCAAGTGCTCAGCCAGTTGGCAGATCTTTTGCGGCAGCAAGGTGTGGACAAC
AGCCGAGTATCGACCTTCCTATCGATTGGACAGCAAGGGCTTCGTAGCGCGGGAGAAGCACAGGCTTCGTCCAGTCGATACCGTTACAACACTGAAGAGC
GACGAACAGAGATCTAGTTTGGGTGCGAGCGATCCATCTGAGGAGTCGAAAAAGAAAACGTTGGCAGCGATTGGCAATTTTGTTTTGTTCGTATTTAAAT
TGGCGACTGAGTTTTTCCATAAAAGATTAGCTGAGAGTTACAAAATAAAGTGATGTATACTATCCTCAGCACTATTACTCATATAAAAGTTGACGCCGCT
CTCTCCATGCCG