Description :
From Genome Similarity Track
Location :
Scaffold_1265:3284- 5483
Transcript NameFunction/comments
Phyag_g10101hypothetical protein PHYSODRAFT_511709

Sequence
2199 bases(100 bases per row)
CACACGCACACACGGCCCGAGGCCGGCGAAATCTCACGTACATGTATTTTCATTGCTATCGAGAGAAGTCCATCGGTTAGTTCGACTCATTGCCATGCCT
ACACCATGTTACACTAAAATATTGAAAGAGAGGGCACTTCGTCCGTGCAGTTCCATTTGTTGTTGGTTCTGAAAAACcttgcttgctgctgtagagGAAG
TTGGCATAGGCCTGTCGAGCATCTTGCCGAGCACCAAGTTGCAAAATCGCAGCCACGATAGTGTACACACTCGCTTTCTGGGGGGCAGGCAACGCCCTTC
ATCTTGATTTTTGGGGGCCACTTGCGCTCGGTGCTGCTAAATTCTGTGGATCTTCTCGATTTCTGCCGTTGTACGTGGACTTCTCCGCCGTGCTTGGTCC
ATTCGACAGGTTGTCGAGGCTGGAGGGTTATGTCATTTTCGTTGTGATGTCTGTCGTCGCTACTCTTGTTGTGTGTTGTGTGTTGATGTGCCTGATCTGT
TGTTGGTATTTCTATCTGTCGGCACGCATGCTAATGCTACCCACGGGGTCTATTCAACCCGCTGCTCCGGGATCCGCTCGAAGCGCCTGTTATTCGAGGC
GCCACAGCTCATATTCTTCGGAGGCCCAATGTGAATGGATCCGCGGTAACTTCCTCCAGCGAAACTGTTCCGAGGCACGCCTACTTGCGCCCGCTGCTCG
CGCGTGCAAATGTAGTGTCCGGCAAGTCCATCGGCTGGGATTAAATAGCCGAGCGTGACCGTGCGTCGCGGACCTTCGCGCACTGACGGCAGGCCTTCTA
CTGGCAGCACGGGGTCAATCTGGAAGCTTTCGTCGTTGGAAATGAGCACCAACTCGATGTTAAACATGCTGGCCACCGCATACAACTCGGCTGTCGTTGC
CTGTTCGTCCGGCGTGTCTCTGAAAGTGTCGTATCGTTCACGcacgtcctcttcgtcctgcatCAAAAAGCCTGCGAGTGCCTTAATGTGTTCCAACGCA
TACTCCATCAACTTGACCCTCAAAAACTGCGCGGCCGCCACTCGTCGAGGCGCCATACCGTCCGCCGCTCCGACATTCACCACCGTCATACTGGCCGGAT
ACTCCCGCAGACACTGCAATGGATACATCTCGTAGACAATGCAGTGCAGCAAGCACGATCCATCAGGCGGCATGCCAACGCCAACCAGTCCCATCTGCAC
GAGTTGATCTTCCATCTTCGCTCGCTGCATGTCCAGCTCCGGCGTAATAACATCCGGCGCAGTCATAGCCATCATGGATCCTCTCGAGACCGAGGCCATC
GATGCACGTCCACCAGTATCCGACACGCCTGACGACGCCGGGAACCAGCTTCCTCTAGAAGATCCACCAGCGAACGAATTGCTGGCAAAAGATCCTCGAC
TGCTGGCAAAAGACGAGCGTCCGGTGCCCATCTGCGCTTGAGGTACAGTATGTCTAGCAAAGCTCTGACTGCCTACAAACCCAGTCCCGGACCAGCGATA
GTCACTGGCCGTGGACGCAAAGGACGAGACCGTCGAACTACTCGAAACCGACcggaagtcgtcgtcgtcgtcgcccatgACGCTGGCCGTGGCCTGCACA
ACCGCAGGCGAGGCCAGAATAGAGGACGACGGCCGTAGATTAATGTCCTGCTGATCGTACTCGGCATTGGCGCCGAATCCCGAGTTGAAACCCACGAAAC
TCTTGAGTGTTTGGCTGCTCACGGCCGCCAAGTGGAAGGCCACGAGCTGCGGCTTGTGCGTGACGACGTTGACGTAGTTGTCGAGCTCTCTGGCCCTCCC
GCCCAGGAACTCTGGGCTTTTATCGGCGCGGAACAGCGCCTTCCTGCGGTACAGCGGCGGGAACTTGACGCCCTTCATGAGCGCCGCGTTGCGCTTGCGC
AGCTGCTCGTCTAGCTTGCggaaggccgagaagctgcgccagATGTGCCACGAAGTGCGGCCCTGGGCGTGCGCGCGCGACGAGTAGAAGGAGAGCTGCA
CCACGACCTTGTActcggccttcttgctgGTGAGGCGGTAGTCGTCCACGCTCACGGCGCACGTGTAGTCGCCCTGGATGTCGTCGGGCGTCATGGTCAG
GTAGGCCATGCGAGGAAGAGGGAGGGGATCCACAGGTGCAAGCAGTCGTAGGGGAGTCGCGCACTGACGCTCAGACTCTGACTTGACGATCGCAAGACG