Description :
From Genome Similarity Track
Location :
Scaffold_529:3284- 4739
Sequence
1455 bases(100 bases per row)
TCCTGAATGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCT
TGACTTCGAGGATTTAAAGATACCTCGAAGTATGTTGGAAGTACGATTGGCAACGGGTGCCGTCGTGAAGTCCGAGAAGCGCATGATACGCGTGCGCTTC
ACGTATGAAGTCAAAAGTGTGTCGAGACCTTTATCGTCCTGGATTTTGACGATAAGTTTGACATTGTATTGGGCATGCCGTGGCTTGCACGACATGATCC
GGTCATCGATTGGGAGAAGCGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCGACAGGTACG
CGCGACTCACCACTCGAGACGGCGCCTAATGCCGCTGTCCTGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAACAGCCAGCGTCGGCGTCGCCGC
CGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCTTTTCAGCGAATCAGGAAGAATCTCCGACCTCAAGGGGCACGGATGACGCAGA
CGAGTCACACGCCTCAGCCGTGGAGGCTAACGCGAATCTGATTGGATCAGGTCTGGCCAAAACTAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGA
GTCGATGGCTTGGGTGAATTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAATGGAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCG
TGTAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTACACGACGAAGAGCCGGGC
GACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATGAACCCGCCGGCGGTACTAAAGAAGAACACTCGTCCATGGCTGGGCCTGGACGAGGTCAAGAAC
CAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTACAAGGAATGTCTGCCGG
GCAGACGGAGGCTGAGAAGCCGGACGTTGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACCCTCGCTAACCCTCCG
ACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCAG
ACGCCGGGAGAACGAAGAGCGAGAAGAACTGAGGCAGTTCTTCATGGAGACCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACGAAGAAGGAGCGC
TTTAAAGAGCAGAGCTGGGGCTCGTTGAAAACGAGTCCCTACTACGAGATCTTAC