Description :
From Genome Similarity Track
Location :
Scaffold_1:32835- 35858
Sequence
3023 bases(100 bases per row)
CCCTTCCATTTTTGTCTGCGTTTTTCTTTTGTCGGTCCACTGCTTCTGCAATGGAATCTTGCACGAAACGGACAACCGTTTTGCGAGCCAGTATGAATTC
ATCTGCTGACTCGCTTTCTTTGACTATAGTGCGCTTGGAGCGCACTGTGGCAAGATCAGTGACCTGGGTAGTTAGAGCATCCTCGCTCTTACTTTCCTCT
TCTTCACCGAAGTCGATGTGATCGATATCGGCGTCATACGTAGTGACCTCGTGGTCAGTACGTGATGAGTGAGAGCCGAGTTGGCGTTCACTCGAACGAT
TCTCCCCCCCCCCTCAAACTATAGTTACACTCTAAGAAGGTGGGTAGGCGTGGGTGGCGCAAGCCATTGACGAAGAACGGTGTATGCGTCGTCGATGCAT
GCACCGAGTTGTTGATGGCGAATTCCACAATTGGCAAGAATTCGCTCCAATTCGTAAACGAATGGACATAACCCCGAACGATTTCCTTAAGAACGCGGTT
TGCACACTCTGTCTGACCATCTGTTTCAGGGTGGTCAGAGGTCGACATCTGAAGGCGCGTACCGAGTGTTTCGAACGCGGATCGCCAGAATTCTGCAATG
AACCGTGGGTCTTGATCAGAGACGAGTTCACGAGGCAACCCATGAAGACGATAGATCGTGTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTGATT
CGGGTACAGCAACCAGATGTATCATTTTACTGAATCTATCAACGTACACAAGAATACCTGTATTCTTGTGTGGGTCTGCGGGGAATCCAAAGACAAAGTC
CGTTGAGACTGATTCCCAGCATTCTGCCGGAATGGGCAAGGGTTGCAACGGCGCACGAAGTGTAGGACCAGACTTCACTTGTTGACATACTTTGCATGCG
CGGACGTACTTACGCACGAGCTGATACTGGCGGGGCCAGTAAAAGTCGCGACTAACTGTGAGATACGTCTTCTCTAGACCAAGATGTCCACCAGTAGGTG
CATCGTGGTACTCATACATGACGCTCAGTCGCAGGTCACCATGGTCCGGTACGACGACACGAGGCGTGTAGCCGGCAACGGCTGAATACTTCAGTAAGAC
ATTGTGGACTGTATATCTATCCGTGGAGGATCGATATACTGGGTGCAACCTTTTAAGGGATTGAAGGGTTGGTTGCGAGAGATGATCTATCAAACGCACC
ATCGCCGGATCGTACGCCTTGCGTATGTATTCGAATAAGGTTGACGACGGGACACTCGACGTCAACACCGCGACAGTGGTCGTACCAGTGTCGGGTTACG
CATCCGGTTCGAAATCAGGCAGAGCATCAGCGACGACATTCAGTCTTCCTGGCTTATATTCCACGGAGAAATTATACTCCGCGAAGAACGACAGCCACCT
CGCCATTTGCTGCGAGAGGTGTGGACTGTTAACGGCCGTGCGTAAGGACGCATGGTCCGTGTAAACGATGAAGGTTCTACCACCTAGCAGGTAGACTCTG
AATTTCGGCAAAGCGTACTTCATGGCAAGGATTTCCTTGTCATGGAATGGGTAGTTACGTTCAGCCGGTTGCAGCTGACGTGACTGATAGCAGACGACAC
GCTCAGCACCGTCTGTGTCGTACTGCATTAGTGCACATCCGATGGCAAAATCACTTGCATCGCAGACCACATGAAATGGTCTGTCTTGGTCTGCAATCGC
CAAAACTGGCGAGCGTATCAAGCAAATCTTGATACCTTCGAAGGAGCGCTGGCAATCAGCACTCCATGCCCACTTCTCGTTCTTTTTCAATAAACGAGAG
AGATGAACAGTCATCTCGGCGTAATTGTGCGAGTATTTGTGCAAATACGCCGCTAGGCCAAGAAAATTTCGAAGTCCTTTTATGTCGGTAGACACCGGCC
AGTCAGTGATCACCTTAATCTTTTCCGGATCGAACCGGACGCCATGGTTACCCACGATGCATCCAAGAAGTGGTATTTCGCTTGCAGCAAATATGCATCA
CTTGAGGTTGGCGTACAACTTATGCTCAAGCATCAGTGTAAGAAACTTTCGGTCGTGGAGTCGGTGAACTTCCAATTCCGTCTGTCCATCCATAGCCCGG
CTATGAAAGAACACATCATCGAAATAGCTAGGTGCGAATTCTTGCACATATATCAACAGATTCGTAACACATCTATTGAACGTATCAGGGGCATTACTCA
GCCCTTGTGGCATTACCAACCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGCTGTGTAAGGAATGTCCTTTTCACTCATAAGGATCTGATAGAACCC
GTCCATCAGATCCATCGATGAAAAGATGGTACTCCTTGCCATACCATCTATAATGACATCCTTTCTTGGTATCGGTGTTTGAGCCGGTACAGTTGCAGCA
TTCAACTTGTTGAAAGCATGTACTATCCGCCATCCTCCTGTGACCTTTCGGACACAGAAGGTCGGAGAGCTATGAGGGGAAGTAGATTCCCTCACATGAC
TCGCTGCCAACCGATTGGCGAAGAATTTGTCAATCGCTAGTACTTGTTCACGAAGCAGTGGCCATTGCTTCATGACACAATAATTTGAACCTGGTTTCAG
GCCGATCTCATGACGAGTACCCTTATCCTTAGGTAGCTTGCACGGCACTGTTCTGGGAACACATCTCTGAATTACGTCAAATCATCGTAGAGAGGATTTG
TCTTGAGCGATTCCCACGATTGGGATGTATATCGATCAATCCGAGTCTTCTCATCGAGGACACTCGTCCATTGAAGAACTGCTGAGAACCCTTTCGTTCT
CAGCAAATACCATTGCCGACCGAATATCGATTACGTACTCGTCTTCCGCGACGAGTACGCAAATCTGCTTGACTTTGCCACTACGCAGATCACGCATGAA
CCTCTTTTGGTTCAGAGGGGGGGGTAACTGAGTGATCTCCGAAGTTGTCTTCGGAGGCGCGATCAGATCATGTGTATGACTACCTATGCTTGATCCGTCG
TTAACCAGAACATCCAATGTCTC