Description :
From Genome Similarity Track
Location :
Scaffold_2331:3283- 5165
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2331-fgenesh-gene-0.0Metalloprotease family M48X
Pytiw_DAOMBR242034maker-piw_contig_2331-snap-gene-0.5Elongation factor

Sequence
1882 bases(100 bases per row)
AGAACGCCTAGGACAGCGAGCTTTCCAGGTACGAGCTTGCCGTTCTTACACTGGTGGATCCCGATCGTGTCGCTTTCACTAACTGCATGAATTTTACGTG
ATACTGCATCAGGAAATCATGCAAGGAGAGCGAATCCTGCCAGCCCTCCATCCGGTACGTGCTCATTTTTGATCTGATCGAAAGGCTCTCTGCTGACACT
ACTGTGGCTCTTTGAATTTGCCGCATCCGCATCAGATGTCGCGTGCTGTGCAGCGCGTGGGCAATAAGATCGTCGAGCAGTCGAATAATTCGAACATGAA
GTGGCAGTTCCACGTGATCGAGTCCCCCGAGCCCAACGCGTTCTGTCTACCTGGTGCGATTCTTTCGCAGCACGCATAGCTCACATGGCCGCATTGCTCA
CCAAGCTGTGTGTGTATCTTTATTGCAGGAGGGAAGGTTTTCGTGAACTCGGGGCTATTCACAGTGCTTCGGAATGAAGACGCGCTGGCTGCTGTGCTCT
TCCACGAGGCGGCACACGGCATCGCTCGTGAGTTTGCTGCTGGAATCCCACATCTATTAGGGTTTGAGAGACTTATGTACGTGCACTTGTATTCATGTTG
ATTCCAGGTCATGGCGCGGAGAAGGTGTCGTTCAGTCTGCTGGTCTACGGGCTGCTGGCCTTCGTCGTTCCAGACTACGGACAGCTGAGTGACTTGGTAA
GCGCTCCTGTGTCTCTTTATCATTCAATTACCAGTTTCATGACTGTGATTGTCCGCTTCCTAGCTCGTAAAGCTTGCGGTGGACTTGCCGTTCTCTCGGA
AGCTGGAGCTGGAGGCCGACTCCATCGGCCTGCGCCTCATGGCCAAGGCCTGTTACGACCCGCGAGCAAGCATCCAGATGAACGCGTCACTGGGCCAGCT
GCAGAAGAACAATGCTGCTGCGCAGTTCAAGTATTTCTCGACCCATCCACCAAGTGCTGAGAGAATTAAAGCTCTGAGGTATGTCGCAAAACCCATTTTG
GCTACTAACAGGAAGAACGACTTCAAGCTGATGGTATTATTAATCGTACAGGGAGCAATTGCGTGACGCGATGGAGATCTACGATGCCTCTGACTGTACC
GAGAAGAAGAGATCTTTCTTGCACGTGAAGACATCCAACCTGGAGCACGAGTGGTAAGCAACCCAACCACAACAGGCAAATAACAAGGAGTCAAATACAT
CTAGACCATCAGTTCAAGCCAACAACTTACAGGAAGTTCATTCGCTCATGATCACTCATTATACCAACAAGATGTGTTAGTTTGCTGAAATAGCAAGCAT
GAATTATTGCATAAAGCTTAAGACACTACTAAAAACAGCAGCGCGCATCGGAAGCGGAAGCACAGCAGACGCTTAGTCCTTGTACTCAACACCGACGACC
TTGCCGAGCATCTTAAGACGGTTCGAGTCCATGACGGCAATACGGGCGAGGCCCTGGCACTGCTCGAAGGTGTCGAGGTACAGAAGAGCGGTAGGCTCGA
AGACGACCTCGGCCTGCTCGAACTGCGAAAGCTCCTCCGGGTTCTCGACCTTCTCGTTGCCGGTCTTCTTCGACATCTTCCAGTTGATGGCGGTCATGCG
GCACGCAACACGGGCGGTACGCGAGAAGATGACCGGGCAGTAGCCCTTCTTGAGGACACCCGGGTGCTCCTGCACGAAGACCATGGCCGTGAAGGTCTTA
ATCGCCTTCAGGATGCCCTGCTTCTCAATGAAGATGACGTCACCGACGGCGATCTTCTCGTCCTTGCCGATACCCTTGATCGACATGCCGACGTTCTCAC
CTGGGCCAGCGGCCGCAAGCTGCTTGTGGTGCTGCTCGATCTGGAACATCTTCTTGCCGCGGATGCCCGAAGGAGCGAAGCC