Description :
From Genome Similarity Track
Location :
contig_163:3283- 4487
Transcript NameFunction/comments
g14486.t1XP_009846822.1 hypothetical protein H257_19374 [Aphanomyces astaci
g14487.t1RAW24142.1 hypothetical protein PC110_g19429, partial [Phytophthora cactorum

Sequence
1204 bases(100 bases per row)
ATCTGGGTGCCGTCGAACACGACTTGGAACAGACCACTCTTGTTGATCTGTGGCACGGAGAGCAGATTCTTGCTCATGCTCGGCACGTACAGCGCGTTCT
TGATCTCGATGTCGCGCTCGTCGCCGTTGGGCAGAACCACTCGTTCCACGATGTGTTGTCAAGAAGGCGCCTCGGGCAGCTGCCGTATACCGGTAGGATA
CCGGTATGACCTTCACTCAGTGGGACCGCAATCATTCCTGTGTTGACGGGACGCTGATGATGGGACGCGGGACACTGATGATGGGACGCTGTTTACGCTA
CGGGGATTACGGGACACGTGGGTACAAGATTGTGGGTACAAGATGGGCATCCACGTGGCAGTCGCTGATTGGCTGAAGCAACTCAGTATCCGGTAAGGAA
TCCAGTAGAGTGTATCCAGTAGAGAATCCAGTAGGCTTAGAGGTAGCAAGGGAGTTTGCGAACTAAGGACCTAAATCAATCACTTTGCATTTTGCCATCA
AGCGACCAAGCCTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGCCCAAGACCCCGACTACGCCTTCGCCATGGACGCCACCCCGACCACGACCGCCCG
CATCAACAAGTTCAACGGAACCAACTTCCACACGTGGAAGTTCAAGATGCAGATGGTGCTCGAGGAGCGCGAACTGTGGGAAGTGACGAGTGGGGAAGTG
AAGCTGGAGCACTGCACGACCACGGCGGATCAAGCGACGTTCAAGAGGAAGTCGCGTAAGGCGCTGGCGATCATCTGTCTCGCGATGGAGGACTCGCAGC
TGCCGCTGGTTCGCTCGGCCAAGGACGCGCATGATGCATGGTCAAGACTGGAAGGACACTTCGAGAAGAAGAGTTTGGCCAACAAGCTCTTTCTTCGTCG
GCGTTTCTTCACGACGATGATGGACGAAGGTGATGATGTGCTGGAGCACATCAACAAGCTCAAGACGCTGGCGGAGCAGCTCGACGCGGTTGGCGCTCCG
GTCAGCGAGGACGACTTGGTGATCACGCTTCTGGGCAGTCTGAGCGAGTCGTACCAGTTCCTGATCACGGCGTTGGAGTCGAGAGCCGACTCGCTGTCGT
GGGAACTCGTGACGTCTCGGCTGCTGCATGAGGACATGAAGCGCAAGGAACAAGGTGGCGGCGGCGTCGACGGAGCCGCGCACGGCCAAGGTCAAGCGTT
CATG