Description :
From Genome Similarity Track
Location :
Scaffold_541:3281- 5091
Sequence
1810 bases(100 bases per row)
CGATTATGACTCGTCTGCTTGCGTTCAAACGTTCGTAGTAAGGCTACACAATTCAAATCAAGTTCATTTATCCAGGAGGGGTCCCCAATACCCTTCCAAC
GGATGCGAAACTCTCGTTGCTGTCGCCCATAACGTGTCTTCATACCAGTACGGCTCTCCATAATCTCTTCGACCTCGTTTTCGCCCTCTTCCAATTCTAT
TACCCAACCATCTTCCGGCAATAGGCATTCATCGAAGTCAACCCGGTCTGCTTCGGTCACTGCCAGCTCGTTGTCGTATTCCACCCCTCGGGTTTCCAAA
CGTACTGCATGGTCTCCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCTAAGATGGACCAGTTTCCTGGCATACCCTTCTTTTACTCGGTTGAT
ATAGATCCATACTTGGGCTTCAGGTATAATCTTGTGGTCGACCACCTCTTTGTTCTGTATTTGCACTCGTACCAGACTCGCTTCTCGCAGTTTCTCATCA
ACCTGTTCCCTTGCTAGCTGGTACTGACTCTGAATGCGGTATCTCCACCTTCTGGGTTCAGACTCCTGACTTTGGATATTCACTATCGGTAACGTGACTT
CAAGGATGGACCTGGCATCCTAACCGTGAAAAAATAAAAAGGCGTTTCTTTTCGCACCCGGTATTGTGCGGTATTAATCGCAAACGTCAACCTCTACGCA
TACTTGTCCCGGTACCGTTGCCCTACGTCAGCGACGTACAATTCGATAGACCTGGTCAGAGTCTGGACCATCCTCTCCGCCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGACCCACTATACGGTTAAACGTTCGGAATAAATACGACATAAATCCCGGTTCTCGATCATGANNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGAAAAAGCACTCTTCATATCCCTTAGAGACCGTCTGATATATCCGCGAAGCGCTAGCCTTGG
CCATTACGTATCCGGTATTTAGATCGACCCGTATTAGCAGCTCTATATTTCTTTCATGCGACTTAGGGAAATACGGAATGTGTCCATCGCTATAACTTGG
AATGGGTAGGTCGCCTCGATGTTTCTGGGGCTCTTCCCTTGTAGGGTAGGTCCACGTTTTCGATCTCACAATCCATGCAGGAACCCACATATCNNNNNNN
NNNNNNNNNAAACATACCTTTGCTGTGATAGTACCGTCGTATGCGTCGGAAGGTACGCCCGATCCCTTCATGAACCCCTTCTAAACTCGTACGGTAGTGG
TGGAGAAAGTAGGTTTGAAGACTTCCCGGTATCATCAGTCTGATCGTCAGGTCACGGCCTTCTCCCTCGGCTCTGGAGATTGGGCATTATATCGATAATC
CTTCTTGGCTTACATCGTAGGCTCCAGACATTTTGCTACGCGATGTAGCGGATTCCACCGGCAGGTCACTCCAGTTCTCATTTAAATATGCCTTCAAATT
TCGTACCCAGCTCTTCTCTTCTTGCGCCTTTTAAATTTGGTCACGCGAAGTCGTTGTACTACCTCCAATTGCATGGTGTCCCCGGTATATTTTGCTGAGA
GACCGCGACCGAATCACCGCAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTGTACTATCCAACCGATTTGCGATCTGATTCAAATCTCGT
TTTAAATGCAGGATACCATGAGAGGGCCACGGTTAAAGTTCATTCAAATACCGGGCTTGTAGCGGGAACAGCCCCGAGGTTTTACACTCAATCTTTCCTC
GCATCTGCTG