Description :
From Genome Similarity Track
Location :
Scaffold_25:32805- 34946
Transcript NameFunction/comments
Phyag_g701conserved hypothetical protein
Phyag_g70260S ribosomal protein L21-1

Sequence
2141 bases(100 bases per row)
TAGTGGTAAGCTGTCCTTGTGTGTAGAATGGCGCCTTGCACAAACTGTGCGTTTGCCGTTGCGCTCTTCAAACATCTCATAGTGTGCTGTAGCCGCCTTC
AAAGCGCTTGGAATCTTCGCAGGCTTCTGCACTATAGATTTGTTGCCACGGGGATGTTTAGAAGCCTGCAAACTACTTGCAACTTCTTGGATGATAGGCG
CCTGTGTTTTCCGGATATAGTGTTTTGGCGGGGGCATATCTCCACGGTATGTCAACCGCGGCAGCTTGTAACGATCATCGAGCTTGATTTTGTACTGCAA
AACCCAAAACATGTGAGTTGAGTTTGGATGAGGGTTCACCACCTATGGGGTCGCAGCATACCTTTTGATCAATGTACTCGATCGCCAGCTCACACACAAA
ATTGCGAAAAGCCCCAGTTTTGTCTGCTTGGCAGTCTTCAAAGACCTTCCTGTTCACTGCCACGTCAAATGCCAGCGAGCTCACtcccttcttgtccttg
acctCGTGTGGAGCACCAAGGCTCAGTGGCACGTGAATTCCCTAACCATGCACAGCATTTAAGAGTCAATCGACTACAAGAATCATGGAGCCAACTGGGA
GAAGCCTCTTGCCTCTTGTTCTTTgccctcgtcgtccagtttTTTCTTTTCCGAAAAGGCTTGAATCTCATCAGCATAAACAAGATTCACAAATACCTAT
CGAGCCATACATCCCAAACGGCCACAGTCAGAAAACGCCACATACTTCCTTCCCACGCCGCTGCCTGGCGGTACATAGATCAAAAGATCAAAAAGCGTTa
tgaccttcttcttgctcttgacgTCGCTTGATTTCATAACGAAACCAGGCTTCACATCAATGTACATCTACTAGCCAGCACACACCAAAGATCAGCTCTC
AATATACTGCTGCAATCCATATGACGACTGAATGGAGTTTGTTTCGCACCCCTTCCGGCGTGGCTTTCAAACCGTCCTCCCCCATGACCTTGTCGCCTGG
AAACCGCGGCTTAAAATCTAGTCGTCGTCAATTGCACAATCCATCACGAGACCCAGGCGAATGCCAATGTAAGTCCACCTCTATCAACCGCTGTGTCCCT
CAATTGTCTGTGTTTTTCAAACCTGGTGAATTGGCGTCTGAAGCTCCTCCCCGTGCACCAGCAGAGCTCTTGAGCATGTCAAacagcgctgcatctgcgt
caCCTTGTGGTGCGCCAGAAGTTCCTTCCTCTCCCAACCCTGCAGCCTGCAATTGGCTCTGCATCGTGGCGATGAACTGTTTGTAGCCTTCCGGAtccgt
cttctccaaattatccagccactgcacagCACAGTCACGAGGCGGTGAGAAAGCGTTCAGCGGCCATTCTGCGTAGAATTTAACGCTCTTTATCGACAAC
GCGGTCACGTACGTCGGCGTACTGCTCCATGGCAGCGTCGTCCATCGGCGCGTTCATCTCTTCGTGGCTGGTTAAGAAAGTGAAGAGTCACGAAAATGTG
GAAAAGGGATATTATCCAACAATTATCCAAATTTTGGATTCTCGAGTGTTTTTACGATCTTTGACGGCAGCATAAGTTATGCTCCCTTGCTGAGGTCGCG
CATCTTGTGTTCGGCATCCGTGAGGTGCTCCTCCCTCATGAGGAACACGAAGTCGAGGCTGACGTGCTCCGCGTCGTTAGCAGTCGCCAGGTCAATACCC
TCACGGATGTCGAACGCAAGATGCGCGACCTCGGCACGAAACTTGGCATACACCCAGTATGGGCGGGCCAAGTGACCGACAACGGAGCGAATTGTTCGTC
TTGACACGCGCGCGCGACCTCGACATCGAGATGCTGTACCGAACGCTGTCGCTGTTCTATCCATAAGCTGTGGAATGTAAGTGTTGATCGGATGCTTGTA
TTTCTCGAGATCTCTGCAAAATAAGCCACCACGGATGAAGGAACTGATACCACCGGGCCCAACTTCGACTGAACCATTGCAAGTCAGACACACTGCTTCT
CTGCTGGAGATCCGCAACATGAAATAATTCGATCAGCAAGAGCGTAAAGCAATTTGACgcaaggaagaagaaaagagGAGGACGCCGTGGATTCGACTCG
TTCTTTCATTTAGCCCAATAGCTCGTTGGGATTTACACCGA