Description :
From Genome Similarity Track
Location :
Scaffold_188:32803- 34747
Transcript NameFunction/comments
Albla_Nc14094340myosinlike protein putative

Sequence
1944 bases(100 bases per row)
TTGGGAAACGCTTCTCGAGTGAGCCGAATCGCCTGAACGATTCCCGCGGATCGGAGCTGATGAATGACGCATTTGATATCGAAATGCCCAGAAATCTTGT
TGGCATTCGGCTTGATACATCGAACGTACTGGACATTGGTGGCCGAAATCACTTGCATCAATTCGCTCAGTTGCGTCTTAAACTTGAAGCTCACAGTCTC
TTGCATGAAATTGGACGATTTTCGAGCCATTATGCCACTTTCCGCGTCGGGAATGGAGAGTTCAGAGACATCAGACGCTCTTCCAGAAAACAATTCAGCG
ATCAAAGTGTTCCGACTCGATCCCAACAACTCCACCAGATGCATAGACAAGCCATCTCTGTTCTTCTCCACGAAATCACAGACGTCATAGATCACACTCT
GAGCGTAATGATGCAACACGAAATGATTGGCAGAGTATTTCGGACCTGCACGTTCCATTCGCGGGTTGTCAGCGTGGAAACTATGGATTTTAGACGCAAA
GGAAGCATCGGAGCCCATCGGTCTCACACATTCTTCATTCAAGAGCGACAAAAGTCCCATTGGATTCTCATACAAATCGAGAATGTCTTGGTTATCTTGA
AACGCAATATGGCTCCAGGGAAGCTCTTCTCGACGATATTCTTCTTCCACGGCCTTGAACACATCGGAAATTAGTTTCTGCTCCAATTTCTCGTTCGCGT
AATTGATACAAAATTGCTCGAAACCATTGATTTCCAACGCCTCAAAGCCGAAAATATCCAAAAGATTGATTTGACGATACGAATGCGATGCTGTGGGTGA
TCGAAGACTTTGATTAATGCGATCCACGAGGTACTGGAAGATTCGAGTGTACAGCTCTTTGGCTAATGCGTCTCGATGATATTTGGCTTGATCGAGACTC
AGAGCGATGCAATAGACTTCCTGGCGAGCTTTGAAGGTGCGATTGCAAAGATGTTGAGAGAATGTCGATAGAGTGTCTGTGAAACCAAGCAAGCTGGCAC
AACGTTGGAGCTGTTCACACTCGGAAGGAGAGGATGACGGGAGATTTCCAGTCGGATCAAGGCTTTCGACCTGCAGAGGAATTTGGAGATTCTGACTCGA
TGGAGACTCAATCTCGGTGAATTGAAGCTGGCCGAGTATCAGGATACCTACCAGCGCTTCAAAAAGTGCGTCTCGATCATGGATGCTCAGTCCAATTGTC
TGGAGAGCGCAATTTGTGAGATGGAAATGCTCCGAATCCGAGGTCTCGAAGGTTCCCCGAAGGTATCGAAATTGTAGATTGTCTTCCCAATGGAATCTCG
GGTCTTTTTGGCTCCACAATTGATAGAAAATATGGAAATTGCGCTCGTCGGGTGCTTGATGGATAACACGTGATTTCTCCAGCAGATAATGACGACAATT
GGCGCCAAGTACGTGAAATTCTGAGTTGAACGAAAGTTGGATGAATTTACCAAATCGACTGGAATTATTATTTTTCACAGTTCTTGCGTTTCCAAAGGCT
TCCAACAATGGATTACTTTGAAGAATCATATCGATGATAGCGTCACGCTGCGGGACTGGAGACAAAGCATTTGTTGCAACATCAATGCTCGCGAGATGCT
GCATGAGAATCTTGACTGTTTCGGTCTTTCCAGCTCCAGATTCACCGCTGACCAAGATACTTTGAGGTTCTCTTCCAAGTCGCATATTGTTGTACGCTTG
CGCGCTGGTTGCATAGACATGCGGAGGAAGCGTGGATCGATTATTGACTGTGTATACATCCTGCAATTCCTTCGTATACAGGTGAGATATCGATTTGTAT
GGGTTCACAGCCACCACAATACCACCGGTATACGTGTACGGGATATCCTTTAGATAACGTTGTCGGAGGTTATAAACTATAGAAGGCTCATGTAAATGAT
ACAAATCGCACATGTCTTCGACCATTACAATGTCCTTCTCGCCC