Description :
From Genome Similarity Track
Location :
Scaffold_541:3280- 5110
Sequence
1830 bases(100 bases per row)
CCGATTATGACTCGTCTGCTTGCGTTCAAACGTTCGTAGTAAGGCTACACAATTCAAATCAAGTTCATTTATCCAGGAGGGGTCCCCAATACCCTTCCAA
CGGATGCGAAACTCTCGTTGCTGTCGCCCATAACGTGTCTTCATACCAGTACGGCTCTCCATAATCTCTTCGACCTCGTTTTCGCCCTCTTCCAATTCTA
TTACCCAACCATCTTCCGGCAATAGGCATTCATCGAAGTCAACCCGGTCTGCTTCGGTCACTGCCAGCTCGTTGTCGTATTCCACCCCTCGGGTTTCCAA
ACGTACTGCATGGTCTCCCACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCTAAGATGGACCAGTTTCCTGGCATACCCTTCTTTTACTCGGTTGA
TATAGATCCATACTTGGGCTTCAGGTATAATCTTGTGGTCGACCACCTCTTTGTTCTGTATTTGCACTCGTACCAGACTCGCTTCTCGCAGTTTCTCATC
AACCTGTTCCCTTGCTAGCTGGTACTGACTCTGAATGCGGTATCTCCACCTTCTGGGTTCAGACTCCTGACTTTGGATATTCACTATCGGTAACGTGACT
TCAAGGATGGACCTGGCATCCTAACCGTGAAAAAATAAAAAGGCGTTTCTTTTCGCACCCGGTATTGTGCGGTATTAATCGCAAACGTCAACCTCTACGC
ATACTTGTCCCGGTACCGTTGCCCTACGTCAGCGACGTACAATTCGATAGACCTGGTCAGAGTCTGGACCATCCTCTCCGCCGNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGACCCACTATACGGTTAAACGTTCGGAATAAATACGACATAAATCCCGGTTCTCGATCATGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGAAAAAGCACTCTTCATATCCCTTAGAGACCGTCTGATATATCCGCGAAGCGCTAGCCTTG
GCCATTACGTATCCGGTATTTAGATCGACCCGTATTAGCAGCTCTATATTTCTTTCATGCGACTTAGGGAAATACGGAATGTGTCCATCGCTATAACTTG
GAATGGGTAGGTCGCCTCGATGTTTCTGGGGCTCTTCCCTTGTAGGGTAGGTCCACGTTTTCGATCTCACAATCCATGCAGGAACCCACATATCNNNNNN
NNNNNNNNNNAAACATACCTTTGCTGTGATAGTACCGTCGTATGCGTCGGAAGGTACGCCCGATCCCTTCATGAACCCCTTCTAAACTCGTACGGTAGTG
GTGGAGAAAGTAGGTTTGAAGACTTCCCGGTATCATCAGTCTGATCGTCAGGTCACGGCCTTCTCCCTCGGCTCTGGAGATTGGGCATTATATCGATAAT
CCTTCTTGGCTTACATCGTAGGCTCCAGACATTTTGCTACGCGATGTAGCGGATTCCACCGGCAGGTCACTCCAGTTCTCATTTAAATATGCCTTCAAAT
TTCGTACCCAGCTCTTCTCTTCTTGCGCCTTTTAAATTTGGTCACGCGAAGTCGTTGTACTACCTCCAATTGCATGGTGTCCCCGGTATATTTTGCTGAG
AGACCGCGACCGAATCACCGCAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGACTGTACTATCCAACCGATTTGCGATCTGATTCAAATCTCG
TTTTAAATGCAGGATACCATGAGAGGGCCACGGTTAAAGTTCATTCAAATACCGGGCTTGTAGCGGGAACAGCCCCGAGGTTTTACACTCAATCTTTCCT
CGCATCTGCTGCACCACTAANNNNNNNNNN