Description :
From Genome Similarity Track
Location :
Scaffold_117:3280- 4891
Transcript NameFunction/comments
Phymu_g4725hypothetical protein

Sequence
1611 bases(100 bases per row)
TGGACACAGCCTGTGTCACACAGGAATACACGATCCGTTCCGGAAGTCTCAAAGACTTAGTACTTAGTCAAGATGTGCATTCTTTCTTCTCTGTCACCAA
CTGTAGACCTCAAGTGCCTAAGTTTGACCGGTGTTGCACTACTTGATTCGGAGTGACGTGCATATGTAGGTACAGAACGACTGGGTGGTTCCtcgtcatt
ttttttatttcgATCGACTTGTCTGGCTggcagtacatgtatcgttACTTCTTGGGTCACGCCAGGTTGCCTCCACTGCAACCGAGGGCTCTAACTGTCC
CGACAGGCCCACGAAGAAATGCTTGCATGCGAGATTCTGTCCGATTTAAGCACCGAAAAGTACAGTTACTTAAGTAGAATAAAACAAGTCTTGAGGCAAT
CTGGTGATCGTAATGGCGAGGCACATCAAGTCTCTACGTACGtagctcgtcctcgtctgCTAGTGACTAAGAGAAATCAGCCATAGGAAATATCCGTGGC
CGTCTTGGCGATACCGTAACATACAAACTCCAGCATAAAAGCATCGATGACGGAACAATTAAGCTCTGGGTAGTTTTTACGATAGAAGGCGTCGTGTTCC
GACCACTTGAGGACCGTGGACGTTGAAGGTGCTTGCTAACGCATAAGATCTCCTGTAATTATTATGCAAACCGTGTGTCGCGTCACATCTGTTGGTTTGC
GGTCAAGACTGCGTACTTAGGTACCCCAAAGCCGTGGATGTCGGCACACAATGACTCACCACAAAGCATGCACAACCCTGGGTCTCAGTTGGAAATTTAC
TTCGTCCGCGATACTCAGACCGAAAAACAAACGTAAAAATGCCCAAGGACCATTTCGTACCCAGTCCGTTCCCGAAGGTGAAAGTGAACGAGTTGGAGCG
ACAAGAACTGCTCCGTATTGTGGATTTGCACGTCGAAAACTACATCAACAAATATGTGGACCACGTCCGTATTGACAAGCGCAAAGTGGACAGTTGCCGT
TGGGAGCACGTCAAGTCCAGAGACAAACTCCACGTATACGCCGAACGCACGCAGAAGGAGCTTAATCGCCGGGGTATCGAGTCGGAAACGTCCCTCAGCG
AAGTACAAGAGCAAATGCCTGTTGTTTTGGGTATCGGAACATTGGTGGGGGAACTGGATGACCTCATGTTCGGCGTTGTGAACCCGACACTGGACGACAT
GCGTATCAAGGCCTCGTACGTCCATGACGTCGACAGTGCAGCGGTTTTGTGTCCCGTGGTAGGACCCAGTAAGGAGGACCCGTTCCGTTCTATCGTgatc
aagtggatggcaaTCGACGTGCCACTACAGTCAACGAATCTGGTGAAGAGTCGAGATTTCGTCTACATCGAGGCCACCGGCACTACATTTCTCCCGAACG
GAGACCGAGTGGGCTACCATTTAATGCATTCGATCGACTTCCCCCAGACGAAGCCATTACCAAAGAGGATCCGCGGTAATCTGTCGGTTTTCAGTTGCTT
TCGGAAGAAATCCGGCTACTTGATTGAGAACTTTTCGTGGGGAATTGTAGACCCCGGAGGTGAAATCATCCGATCGCTTGCACTTTCCGTCGCAGCGAGT
GCTCTTCTCTC